ID: 997882069

View in Genome Browser
Species Human (GRCh38)
Location 5:137600285-137600307
Sequence CAACCAGAGCTCCCTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997882058_997882069 21 Left 997882058 5:137600241-137600263 CCCGATGTGGGCTCCTTCCCCAC No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data
997882062_997882069 4 Left 997882062 5:137600258-137600280 CCCCACTGACAGCTAAGTGGCTG No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data
997882060_997882069 8 Left 997882060 5:137600254-137600276 CCTTCCCCACTGACAGCTAAGTG No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data
997882064_997882069 2 Left 997882064 5:137600260-137600282 CCACTGACAGCTAAGTGGCTGTC No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data
997882059_997882069 20 Left 997882059 5:137600242-137600264 CCGATGTGGGCTCCTTCCCCACT No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data
997882057_997882069 22 Left 997882057 5:137600240-137600262 CCCCGATGTGGGCTCCTTCCCCA No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data
997882063_997882069 3 Left 997882063 5:137600259-137600281 CCCACTGACAGCTAAGTGGCTGT No data
Right 997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997882069 Original CRISPR CAACCAGAGCTCCCTGGGGC AGG Intergenic
No off target data available for this crispr