ID: 997884027

View in Genome Browser
Species Human (GRCh38)
Location 5:137614893-137614915
Sequence GACACTGGGGTCTTTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997884022_997884027 -8 Left 997884022 5:137614878-137614900 CCCAACACTGGGAAGGACACTGG No data
Right 997884027 5:137614893-137614915 GACACTGGGGTCTTTCCCAGAGG No data
997884024_997884027 -9 Left 997884024 5:137614879-137614901 CCAACACTGGGAAGGACACTGGG No data
Right 997884027 5:137614893-137614915 GACACTGGGGTCTTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997884027 Original CRISPR GACACTGGGGTCTTTCCCAG AGG Intergenic
No off target data available for this crispr