ID: 997890146

View in Genome Browser
Species Human (GRCh38)
Location 5:137668847-137668869
Sequence ATGAATCAACAGATGAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997890144_997890146 -7 Left 997890144 5:137668831-137668853 CCATGGAAATCAGCAAATGAATC 0: 1
1: 0
2: 6
3: 51
4: 350
Right 997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG 0: 1
1: 0
2: 2
3: 46
4: 363
997890142_997890146 13 Left 997890142 5:137668811-137668833 CCTTGATGAAAATATTTACACCA 0: 2
1: 6
2: 51
3: 207
4: 787
Right 997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG 0: 1
1: 0
2: 2
3: 46
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997890146 Original CRISPR ATGAATCAACAGATGAATCA GGG Intronic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
902063123 1:13661876-13661898 ATGAATGAAATGATGAATGAAGG - Intergenic
902370764 1:16005557-16005579 ATGAATAAACAAATGAATTCAGG + Intronic
902824795 1:18965628-18965650 ATGAATCCACAGCTGAATGCAGG + Intergenic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
904050866 1:27637467-27637489 AGGAATTAACAGATGAACAAAGG + Intergenic
904067076 1:27761649-27761671 ATGAATGAACAGATTAAAAATGG + Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907536701 1:55168082-55168104 AGGAGTCAACAGAGGAAACATGG + Intronic
908007813 1:59744701-59744723 ATGAATTAATGAATGAATCAGGG - Intronic
908046713 1:60178383-60178405 CTGAATCAACAGGTAAATAAGGG - Intergenic
909195802 1:72621521-72621543 AAAAATCAACAAATAAATCAAGG - Intergenic
909368865 1:74860971-74860993 ATGAAACAACGGTGGAATCAGGG + Intergenic
910140287 1:84019719-84019741 ATAAATCAACAAAGGAAACATGG + Intergenic
910178884 1:84460081-84460103 AGGAATCAATAAATGAATGAGGG + Intergenic
910533944 1:88274850-88274872 ATGAATCAACCAATGAATGGAGG + Intergenic
911200674 1:95040318-95040340 ATGAAGCAACATATGAGTAAGGG - Intronic
912915280 1:113808602-113808624 ATGATTCAATAGGTGAACCATGG + Intronic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
916705506 1:167345183-167345205 AAGAAAGAACAGATGAGTCAGGG + Intronic
916707933 1:167372288-167372310 ATGAAGCAACACCTGAAACAGGG - Intronic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
918329158 1:183440380-183440402 ATGAATAAACAAATAAATTAGGG + Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918632558 1:186735594-186735616 ATGATTCAGCATATGAGTCATGG - Intergenic
918928962 1:190827996-190828018 ATCTATCAAGAGATGAATAAAGG - Intergenic
920689303 1:208133802-208133824 CTGAATTACCAGAAGAATCAGGG - Intronic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
921508619 1:216004996-216005018 AAGAATCAAAAGATCACTCATGG - Intronic
922958869 1:229627472-229627494 ATGAATCAACAGATTTGTCGGGG - Intronic
923144691 1:231189803-231189825 AGGATTCAACATATGAATCTGGG + Intronic
1063313099 10:4974082-4974104 ATGAAACAATTGATGAATCTAGG + Intronic
1063314896 10:4993971-4993993 ATGAAACAATTGATGAATCTAGG - Intronic
1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG + Intergenic
1063981494 10:11455664-11455686 TTGAATCTATAGATGAGTCAAGG - Intronic
1064854139 10:19746540-19746562 ATGAATTATCACATAAATCATGG - Intronic
1065270364 10:24025577-24025599 ATGAATCTACAGATGAATTGGGG + Intronic
1065658671 10:27981784-27981806 ATGAATGAACAATTGAATGAAGG - Intronic
1065801000 10:29352258-29352280 ATGAATCAAGGGATGATTGAGGG + Intergenic
1065861188 10:29873573-29873595 ATCAATCAACAGAGGAATCCTGG + Intergenic
1070317198 10:75325683-75325705 ATGAATCTACAGATCAATTTGGG + Intergenic
1071421744 10:85507144-85507166 ATGAATAAATAAATGAATTATGG - Intergenic
1072456474 10:95580735-95580757 ATGAATCAATGAATGAATGATGG + Intergenic
1075595625 10:123727138-123727160 ATGCATGAACACATGAACCATGG + Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1080609241 11:33889527-33889549 ATGAATGAACAAATGAGTGAAGG - Intronic
1080659197 11:34282232-34282254 AGGTATCAACATATGAATCTGGG + Intronic
1081998811 11:47381035-47381057 ATGAATGAACACATCAAGCAGGG - Intergenic
1082228118 11:49732096-49732118 ATGAAACATCAGTTCAATCATGG - Intergenic
1084508698 11:69587896-69587918 ATGAAACATCAGATAAAACAAGG - Intergenic
1085500852 11:77022082-77022104 ATGAATTAAAAAATGTATCACGG - Exonic
1085876834 11:80417710-80417732 ATGAAAAAACAAATGAATCCTGG + Intergenic
1086227350 11:84528048-84528070 ATGAATCAAGAGAATAATCTAGG + Intronic
1086570887 11:88283096-88283118 AAGAAAAAAAAGATGAATCAGGG + Intergenic
1086621937 11:88897067-88897089 ATGAATCATCAGTTCAATCATGG + Intronic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1087434498 11:98096940-98096962 CTGAATCAAAAATTGAATCAAGG - Intergenic
1087625557 11:100592196-100592218 ATGAATGAATAGATAAATAAGGG - Intergenic
1087910856 11:103751853-103751875 ATGAATGAATACATGAATAATGG - Intergenic
1088354167 11:108924497-108924519 CTGAATCAAAAGACTAATCAAGG + Intronic
1088948859 11:114544371-114544393 AAGAATGAACAGATTAATCAAGG + Intronic
1089059045 11:115611177-115611199 AAGAATCAATACATGAATCAGGG - Intergenic
1090246251 11:125218007-125218029 TTGAATCACCAGATCAAACAGGG - Intronic
1090268016 11:125366407-125366429 ATCAATGAATAGATGAATGATGG - Intronic
1090566931 11:128004940-128004962 GTGAATGAACATATGAATGAAGG - Intergenic
1091516758 12:1191937-1191959 CTGAATAAACAGTAGAATCATGG + Intronic
1091918858 12:4288570-4288592 ATGAATGCACAGAGGATTCAAGG - Intronic
1092210445 12:6642949-6642971 AAGAATCAAGAGTTGACTCAAGG + Intronic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1095045321 12:37497124-37497146 ATAAATCAACAGCTGAATGGTGG + Intergenic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1095503072 12:42861806-42861828 TTGAATCAATAGATGAATGAAGG - Intergenic
1096416870 12:51422088-51422110 TTGAATTAATAGATGAATGATGG + Intronic
1097890860 12:64776296-64776318 ATCATTCAAAAGATGAATCCAGG + Intergenic
1099315339 12:81077228-81077250 ATGAATCAAAAGAGGAAACTGGG - Exonic
1099597696 12:84688840-84688862 ATGAATCTTCAGGTGAATGAAGG + Intergenic
1099657655 12:85514872-85514894 AAGATTCAAAAGATAAATCAGGG - Intergenic
1099666523 12:85637101-85637123 ATGAATCCACAAGTGAATAAAGG - Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100160397 12:91853534-91853556 AAGAATAAAAAGATGAGTCAGGG + Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1101707846 12:107237205-107237227 ATGAATCAGGAAATGAGTCAGGG - Intergenic
1101993767 12:109509976-109509998 AAGAATCAACAGGAGATTCAGGG - Intronic
1102316599 12:111893394-111893416 ATTAGTAAACAGTTGAATCAAGG + Intronic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1103771268 12:123327297-123327319 ATAAAACAACAGATGAAGCCAGG - Intronic
1104163857 12:126206845-126206867 ATGAATCAACCAATCAATCAAGG - Intergenic
1105395324 13:20028019-20028041 ATGAATTAACTCATGAAGCATGG - Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106324430 13:28674618-28674640 AGCAAGGAACAGATGAATCAGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108828039 13:54440116-54440138 AAGAACCAACATATGAATAATGG - Intergenic
1109115242 13:58373786-58373808 AAGATTCAACAGACAAATCAAGG + Intergenic
1109543257 13:63808650-63808672 GTGATTCAACAGATAAACCACGG + Intergenic
1109575459 13:64250545-64250567 ATGAAGGAACAGATGACTAATGG + Intergenic
1110837656 13:80103194-80103216 CTTAATTAACAAATGAATCAAGG + Intergenic
1110948462 13:81454788-81454810 ATGATTTAACAGATTAAACATGG + Intergenic
1111297453 13:86300244-86300266 AAGAATTTAAAGATGAATCAAGG - Intergenic
1111351124 13:87032843-87032865 ATCAATCAATAGATCAGTCAAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113653023 13:112050639-112050661 ATGAATGAAGAAATGAATGAAGG + Intergenic
1114329696 14:21624139-21624161 ATTAATCATCAGCTGAATAAGGG + Intergenic
1115166179 14:30451188-30451210 ATGAATCAGAAGATTAAGCATGG - Intergenic
1116140431 14:40986606-40986628 ATGCATGAACAGATGAGTTAAGG + Intergenic
1116149627 14:41123614-41123636 ATGAATGAACAGTTGAGTGAAGG + Intergenic
1116226570 14:42161159-42161181 CTGAATCAACAGACAAATAAAGG - Intergenic
1117028184 14:51642854-51642876 ATGAATCAACAAATCAATGATGG + Intronic
1118329840 14:64806643-64806665 ATGAGTGCACAGAAGAATCAAGG - Intronic
1118656108 14:67950677-67950699 ACGTATCAAAAGCTGAATCAGGG - Intronic
1119011436 14:70993933-70993955 ATAAATCAACAGATAAATCTTGG - Intronic
1119413234 14:74451000-74451022 ATGAATCCATAGATCAATCTGGG - Intergenic
1119587918 14:75855381-75855403 ATGAATCAACATTTGAAAGAAGG + Intronic
1120312930 14:82854436-82854458 ATGAATAAAGAAATAAATCATGG - Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1121016115 14:90550281-90550303 ATACATCAACAGATGAGGCAGGG - Intronic
1122015115 14:98788654-98788676 AAGAATCAAAAGCAGAATCAAGG - Intergenic
1123188958 14:106549620-106549642 ATGAATCAACAGATAAAATGTGG + Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1124988637 15:34648561-34648583 ATGAATCTACGGATGTATCAGGG - Intergenic
1125502679 15:40249265-40249287 AGGTTTCAACAGATGAATCTTGG + Intronic
1125502684 15:40249295-40249317 AGGTTTCAACAGATGAATCTTGG + Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126501348 15:49348957-49348979 ATGACTCAACGGAAGAATAAGGG - Intronic
1126919751 15:53507995-53508017 AAGAATAAACAGAGAAATCAGGG - Intergenic
1128420913 15:67490944-67490966 ATGAAATAAGAGATGACTCAAGG - Intronic
1128602401 15:69008574-69008596 ATGACTCAACAGGTTAAACAAGG + Intronic
1128828068 15:70739461-70739483 ATGAATAAAGGGATGAATTAAGG + Intronic
1129567953 15:76643991-76644013 ATGAATCAAATCATGAAACATGG - Intronic
1130905589 15:88238768-88238790 TTGAATCAAGAGCTGAATCACGG - Intronic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1132319062 15:100911491-100911513 ATGAATGAGCAAATGAATGATGG - Intronic
1133078572 16:3299617-3299639 TTGATTCAACCAATGAATCAAGG - Exonic
1133540310 16:6746186-6746208 TTGAATCTACAGATCAATTAGGG - Intronic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1134231180 16:12431848-12431870 ATGAAAGAACAAATGAATGAAGG - Intronic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1136227678 16:28869953-28869975 GTGAATGAACACATGAATCATGG + Intronic
1139294798 16:65891112-65891134 AGGAATCAAAAGAGAAATCAAGG - Intergenic
1140626652 16:76802836-76802858 ATGATACAAGAGATGAATGAAGG + Intergenic
1141031964 16:80596923-80596945 ACGAATGAACAGAAGAATGACGG + Intergenic
1141053985 16:80799470-80799492 ATGAAATAACAAATGAATGATGG + Intronic
1141112624 16:81282601-81282623 ATGAATCAATAGATGATGCCAGG + Intronic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1143054498 17:4152712-4152734 ATGAATAAAGAAAGGAATCAGGG - Intronic
1143444263 17:6997902-6997924 ATGAATCCAGAGATGAGTGAGGG + Intronic
1144354544 17:14432383-14432405 ATGAATGAGCACATGAATGAAGG + Intergenic
1144577152 17:16436393-16436415 ACGAATCCAGAGATGAACCAAGG - Intronic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1146464904 17:33078744-33078766 ATCAATCAACCAATCAATCATGG - Intronic
1147748962 17:42715645-42715667 AAAAAACAACAGATGAATCCAGG + Intronic
1148295585 17:46499587-46499609 AGGAGTCAACAGATGAGCCAGGG + Intergenic
1149192166 17:54076132-54076154 ATGATTCTGCAGATGAATCTGGG + Intergenic
1149382787 17:56110596-56110618 ATGAATGAACAAATGAGTGAAGG + Intergenic
1149448289 17:56730765-56730787 ATGAATGAAAGAATGAATCAAGG - Intergenic
1150407012 17:64910366-64910388 AGGAGTCAACAGATGAGCCAGGG - Intronic
1150509920 17:65739817-65739839 AAGAAACAACAGATGAAGTAAGG - Intronic
1152314051 17:79569798-79569820 GTGTATGAACAGATGAATTATGG + Intergenic
1153328949 18:3852550-3852572 ATGAATCAACAGAGAAATGTCGG + Intronic
1155430764 18:25754617-25754639 GTCCATCAACAGATGAATAAAGG + Intergenic
1156640536 18:39090427-39090449 ATAAATCAATAAATAAATCATGG - Intergenic
1157133605 18:45032513-45032535 ATGAGTGAAGAGATGAATGAAGG - Intronic
1158026937 18:52910399-52910421 ATTAATCAACAAATGAAACTAGG - Intronic
1158698770 18:59727604-59727626 ATCAATCAGCAGATCAGTCAAGG + Intergenic
1159725368 18:71951316-71951338 GTGAATCAAGAGATGTAACAAGG - Intergenic
1160049173 18:75415692-75415714 ATGAATAAGCAGATGATTGATGG - Intronic
1161785082 19:6319498-6319520 ATGAATGAACGAATGAATGAAGG - Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1162891522 19:13736610-13736632 ATGAATCAATAAATGAATGAGGG - Intronic
1163262060 19:16197304-16197326 ATGACTCAATGGATTAATCAAGG + Intergenic
1165875591 19:39004469-39004491 AGGATTCAACATATGAATCTGGG - Intronic
1165931205 19:39360359-39360381 ATGAATGAATATATGAATCAAGG + Intronic
1167218680 19:48182875-48182897 ATGAATGAACGGATGAATGGAGG - Intronic
925248662 2:2409802-2409824 CTGAAACAAAAAATGAATCATGG - Intergenic
925516475 2:4689201-4689223 ATGAATCAATTCATGAATGAAGG + Intergenic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
926135307 2:10331876-10331898 CTGAATCAACAGGTGACACAGGG - Intronic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926887086 2:17607747-17607769 ATAAATTAACAAATGAATAAAGG + Intronic
926993832 2:18711914-18711936 ATGTAGCAAGAGATGAAACATGG - Intergenic
927144191 2:20150671-20150693 ATCAAACAGAAGATGAATCATGG - Intergenic
927462472 2:23310869-23310891 ATGACTGAACAAATGAATAAGGG + Intergenic
927875279 2:26651070-26651092 ATGAATCAGCAGATGCCTCAAGG - Intergenic
930790720 2:55325132-55325154 TTGAATCAAGAGATCAATCTGGG + Intronic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
931110203 2:59102172-59102194 ATGAATAAACAGATATATCTTGG - Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932851665 2:75193535-75193557 GTGAATTCACAGGTGAATCAGGG - Intronic
932860015 2:75281292-75281314 ATGGATGAACAGTTGAGTCAGGG + Intergenic
933418307 2:82015319-82015341 ATCAATCAACAGATAAATTTGGG + Intergenic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
935452691 2:103228408-103228430 TTGAATAAAAAGATGAATTAAGG - Intergenic
935511947 2:103986734-103986756 ATGAATGAACAAATGAAACTAGG - Intergenic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
936688674 2:114859517-114859539 TTGATTCAACAGATTATTCACGG + Intronic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
938551667 2:132387873-132387895 ATTAATCAACAAGTGAATAAAGG - Intergenic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
940619355 2:156091588-156091610 ATGATTACAAAGATGAATCATGG - Intergenic
941621593 2:167785154-167785176 TTGAATCAAGATATAAATCAAGG + Intergenic
941789276 2:169533830-169533852 ATGTTTCAACAGATGAATTTTGG - Intronic
942122034 2:172787548-172787570 ATGAATGAATAGATAAATGAAGG + Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
942871598 2:180740821-180740843 ATGAATCACAAGATGTATAATGG - Intergenic
943069894 2:183128260-183128282 ATGAATCAAAAAATAAATTAAGG - Intronic
943242354 2:185401119-185401141 ATGAATCAGCAAATGTCTCAAGG - Intergenic
943550518 2:189332966-189332988 ATGGATCAAAAGAGAAATCACGG + Intergenic
943887468 2:193239959-193239981 ATGATTGAACAGATCAATGAGGG - Intergenic
944091259 2:195914556-195914578 ATGAAGCATCAAATGAATCAGGG - Intronic
944475070 2:200095292-200095314 ATAAATCAACAGCAGAAGCACGG + Intergenic
944649177 2:201811622-201811644 ATGAATAAAATGATGAATGAGGG + Intronic
946903592 2:224395211-224395233 ATGCATCAGCAGGTGAATCAGGG + Intronic
947128406 2:226896103-226896125 AGGAATCAACACATGAAATATGG + Intronic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1171539875 20:25940729-25940751 ATAAATCAACAGCTGAATGGTGG + Intergenic
1171842790 20:30235947-30235969 ATAAATCAACAGCTGAATGGTGG + Intergenic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173011681 20:39189048-39189070 GTGAATCAGCAGAAGAATAAGGG + Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173057691 20:39632049-39632071 ATTAATGAACAAATGAATGAAGG - Intergenic
1173925036 20:46774776-46774798 ATGAATGAACAAATCAACCAAGG + Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1174194996 20:48766702-48766724 TTGAATCATCACATAAATCAAGG - Intronic
1174693745 20:52536462-52536484 CTGAATCAACTGATGAGCCAAGG - Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177468800 21:21527405-21527427 GTGAATGAAAAGACGAATCACGG + Intronic
1178096217 21:29218614-29218636 ATGCATCAAGAGATAAGTCATGG - Intronic
1178227770 21:30742775-30742797 TTGAATCAACAAATCAATAATGG - Intergenic
1179648333 21:42789835-42789857 ATGAATCAAAAAATTAATTATGG + Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1181118085 22:20646512-20646534 CTGACTCAACAGATGAGGCAGGG + Intergenic
1183647606 22:39135439-39135461 ATGAATCTACAAAAGATTCATGG + Intronic
1184132545 22:42525909-42525931 AAGAATGAAAAGATGAGTCAAGG + Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
949730475 3:7106553-7106575 AGCAATCAACAAATGAATAATGG + Intronic
951580147 3:24154189-24154211 TGAACTCAACAGATGAATCATGG - Intronic
951632160 3:24734152-24734174 ATGAATCATCAGTAGATTCATGG + Intergenic
952284191 3:31952575-31952597 AGGAATCAACAACTGAATGAAGG + Intronic
952932871 3:38373759-38373781 GTGAATCAACATGTGAATAAAGG - Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
957762854 3:84581910-84581932 ATGTAACAAGAGATGAAACATGG + Intergenic
957849953 3:85794848-85794870 ATGAATCAACATCTGAAGGATGG - Intronic
958047293 3:88301696-88301718 GTGAATAAATAAATGAATCAAGG - Intergenic
959410745 3:106018077-106018099 AGGTATCAACATATGAATCTGGG - Intergenic
959686606 3:109154091-109154113 ATGAATCAATAAATGATACAAGG - Intergenic
960440273 3:117678317-117678339 ATGAATGAAAGGATGAATAAAGG - Intergenic
961479601 3:127171431-127171453 ATAAATGAAAAGATGAATCCTGG - Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963497614 3:146086540-146086562 TTTAATCAAATGATGAATCAAGG - Intronic
965193630 3:165564413-165564435 TTGAATCAAGGGTTGAATCAAGG + Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
966163849 3:176995039-176995061 ATGGAAGAAAAGATGAATCATGG - Intergenic
968875505 4:3265172-3265194 ATCCAACAAAAGATGAATCAAGG - Intronic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
969921242 4:10541821-10541843 ATGATTAAATAGATGAATGAAGG + Intronic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
971267506 4:25108333-25108355 AAGAGTCAACAGATGGTTCATGG - Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972819837 4:42688016-42688038 ATGAATAAATATATAAATCATGG + Intergenic
974338655 4:60585608-60585630 ATGACTCAACAAAAGAAGCAGGG + Intergenic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
975205224 4:71637919-71637941 ATGAGTGATCAGATGAATCCTGG + Intergenic
975599385 4:76083582-76083604 ATGAATCAACAAACAAAACATGG - Intronic
976256415 4:83105255-83105277 ATCAATGAACAAATGAATGAAGG - Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977642809 4:99376274-99376296 ATGAATGAATAGATAAAGCAGGG - Intergenic
979307941 4:119169612-119169634 ATGAATCAACAGGTGCCTCAAGG - Intronic
981132768 4:141176316-141176338 ATGTTTCAACATATAAATCATGG + Intronic
981212175 4:142120398-142120420 ATGAATCTATAGATCAATTATGG + Intronic
981726080 4:147848772-147848794 ATGAGTCAATAGAAGATTCAAGG - Intronic
981869285 4:149467342-149467364 ACGAATAAACAAATGAATTAAGG - Intergenic
982069370 4:151682110-151682132 ATGACCCAACTGATGAATTAAGG - Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984522451 4:180817873-180817895 ATGCATCAAAAGGTGAAGCAGGG + Intergenic
984674341 4:182529672-182529694 ATAAATGAACAAATGAATGAAGG - Intronic
984677131 4:182562712-182562734 CAGAAACAAAAGATGAATCAGGG - Intronic
987451914 5:18095590-18095612 ATGAATAAAAAGATGAATACAGG + Intergenic
987551700 5:19390962-19390984 TTGAATCTACAGATTAATTAAGG - Intergenic
988850826 5:35179283-35179305 ATGAATCAAGACAGGAAACAAGG - Intronic
988865929 5:35335050-35335072 ATGAATGAACCAATGAATGAAGG - Intergenic
989146422 5:38255420-38255442 ATAAATCAAAAGATGATTCTTGG + Intergenic
989811569 5:45683402-45683424 TTGAACCAACAGATAAATTATGG - Intronic
989993983 5:50804984-50805006 CAGAATCAACAGCTGAATCTTGG - Intronic
990420556 5:55628315-55628337 ATGAAAAAACAGAAGAATCCTGG + Intronic
990887398 5:60610148-60610170 ATGAATGAATACATGAATGAAGG + Intronic
992405229 5:76450929-76450951 GTGAATTAACACATGATTCAGGG - Intronic
993460449 5:88175435-88175457 ATTAGTCAACAAATGAACCAGGG - Intergenic
993611513 5:90060093-90060115 ATGAATGAACACATTAAACATGG - Intergenic
994176541 5:96718068-96718090 CTGAATCAACAGGTGAGTCAAGG + Intronic
994805472 5:104441926-104441948 ATTAATTAACATATGAATCAGGG - Intergenic
995140037 5:108725514-108725536 ATAAATGAATAAATGAATCAAGG + Intergenic
995607771 5:113876210-113876232 ATGAATAAACAGATACATCTTGG + Intergenic
995806873 5:116063215-116063237 ATGAATGAATAAATGAATAATGG - Intergenic
995882271 5:116856423-116856445 TTGAATCAATAGATTAATCTGGG - Intergenic
996690549 5:126335570-126335592 ATGAATGAACAGTGAAATCAGGG - Intergenic
996840880 5:127846314-127846336 ATGAATGAATACATGAAACAAGG + Intergenic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
998703193 5:144729383-144729405 ATGAAACAACAGATTAAACAAGG - Intergenic
999382431 5:151131003-151131025 ATGAGTCAACAGATGAACTTAGG - Intronic
999749752 5:154618895-154618917 ATGAATCAGCAGATGGATGTGGG + Intergenic
1000325299 5:160167571-160167593 TTGAATTGACAGATGAATGAAGG - Intergenic
1000879070 5:166676359-166676381 ATGAATCAACAGAAGATGAATGG - Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1001748321 5:174108994-174109016 ATGAATTTACAGGTGACTCAGGG - Exonic
1001795217 5:174496507-174496529 ATCAATCAAAAGATGAAATAAGG - Intergenic
1002923298 6:1589134-1589156 ATCAATCAACCAATCAATCAAGG - Intergenic
1002973394 6:2048597-2048619 ATAAATCTACAGATGAATTAGGG + Intronic
1003055524 6:2815240-2815262 ATTAATCAACAGATCAATTTGGG + Intergenic
1005358272 6:25006236-25006258 ATGAATAAACGAATGAATGAAGG - Intronic
1007283887 6:40733616-40733638 ATGGATTAATAGATGAATAAGGG + Intergenic
1007602797 6:43093770-43093792 ATGAAGCAACAGAAGAACGAAGG + Intronic
1008241060 6:49112449-49112471 AAGAAGCAACAGAGGAATCCAGG + Intergenic
1008326012 6:50182380-50182402 ATAAATAAAAAGATGACTCAAGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009699553 6:67158979-67159001 TTGAATCAATATATGCATCACGG + Intergenic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1011435478 6:87332054-87332076 ATGAATCAATAAAATAATCAGGG - Intronic
1011796106 6:90954300-90954322 CTGAATCAATAGAAGAATTAGGG - Intergenic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1013018651 6:106186643-106186665 AAGAATCAAGTGATGATTCATGG - Exonic
1013654665 6:112233428-112233450 GGGAATCAGAAGATGAATCATGG + Intronic
1015033278 6:128622421-128622443 ATAAATAAATAGATGAGTCAGGG + Intergenic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015591597 6:134827967-134827989 AAGAATAAAGAGATGAATCCCGG + Intergenic
1015631918 6:135239732-135239754 TTGAATCAACAGAGGATACATGG - Intergenic
1015793245 6:136985436-136985458 AGGATTCAACATATGAATCTTGG - Intergenic
1016822965 6:148363216-148363238 ATGCAACATCAGATGAATCACGG + Intronic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1019263329 7:94957-94979 ATGAATTAACTGATCATTCAAGG + Intergenic
1019827543 7:3297139-3297161 ATGAAGCAAAAGAGGAATGAGGG + Intergenic
1020395510 7:7712567-7712589 AAGAATCTAAAGATGAATTATGG - Intronic
1020427853 7:8090271-8090293 TTGAATCAACATGTGAATTAGGG - Intronic
1023150201 7:37194910-37194932 ATGAATGAATAGATCAATTAAGG - Intronic
1023814835 7:43941653-43941675 ATGAATCAGGAGAAGAACCAAGG + Intronic
1024100051 7:46022635-46022657 ATAGATCAAAAGATGAAGCAGGG - Intergenic
1024210411 7:47198427-47198449 ATGAGGCTGCAGATGAATCAGGG - Intergenic
1024781142 7:52849848-52849870 ATGAATGAATAAATGAACCATGG - Intergenic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1025291253 7:57726651-57726673 ATAAATCAACAGCTGAATGGTGG + Intergenic
1027220427 7:76210475-76210497 ATGAATGAATGAATGAATCAAGG - Intronic
1027536836 7:79413885-79413907 TGGAATAAACAGATGAATAATGG - Intronic
1028061935 7:86330634-86330656 CTGAAACACCAAATGAATCAAGG - Intergenic
1029232605 7:99083617-99083639 TTGAATCAACACAGGAAACAGGG - Intronic
1031090015 7:117343095-117343117 ATCAATCAACAAATGGATAAAGG - Intergenic
1031475268 7:122213481-122213503 CTGAATCAACAGGTGAAAGAGGG + Intergenic
1031856907 7:126933950-126933972 ATGTATCAACAAATATATCAAGG - Intronic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1034099846 7:148441453-148441475 ACCCATCAACAGATGAATAAAGG + Intergenic
1036060588 8:5314594-5314616 ATGAAGCAACAGATGAAACTGGG + Intergenic
1041970926 8:63741821-63741843 ATGAATGATTAAATGAATCAAGG - Intergenic
1042030771 8:64472979-64473001 ATAAATCAACGAATGAATAATGG + Intergenic
1042757494 8:72232593-72232615 ATGATACAACATATGAATTATGG - Intergenic
1043255457 8:78131084-78131106 ATGAATCATCAGAGGGAACAGGG + Intergenic
1043809954 8:84727020-84727042 ATGAAACAGCAGATGAAGCTTGG + Intronic
1044040342 8:87358979-87359001 TTGAATCAGTAGATGAATTAAGG - Intronic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044229937 8:89762217-89762239 ATGAATAAACAAATGAACCTGGG + Intronic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1044894698 8:96879059-96879081 TTGAATCAACAGATTAATATAGG + Intronic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1045446112 8:102266037-102266059 ATGCATCAATAGCTGAATGAAGG - Intronic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046089868 8:109488886-109488908 ATGAACAAACAGATGATTAAAGG + Intronic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1047456713 8:125020499-125020521 ATGAATTAACAGCAAAATCAAGG + Intronic
1047926799 8:129690081-129690103 ATGAATGACCAGATAAATGATGG + Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1052728371 9:32257545-32257567 ATCAAGCAACAGATTAATCACGG + Intergenic
1053273774 9:36767948-36767970 CTGAATCCATAGTTGAATCAGGG + Intergenic
1054165192 9:61718720-61718742 ATAAATCAACAGCTGAATGGTGG - Intergenic
1054821313 9:69523125-69523147 ATGATTCAGCAGTTGAATCCAGG + Intronic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1055397071 9:75887630-75887652 TTGATTTAACAGATGAATGAGGG + Intergenic
1056000512 9:82211372-82211394 TTGAATCTACAGATGAATGTAGG - Intergenic
1058196301 9:101980634-101980656 CTGAATCAACAGATAAATTAAGG + Intergenic
1058756509 9:108087747-108087769 ATGAATGAACAAATTAATTAAGG + Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059832961 9:118118989-118119011 ATGAAACAAAAGATGTCTCAAGG - Intergenic
1060193469 9:121607794-121607816 ATAAATAAGCAGATGAATGAGGG + Intronic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188349193 X:29106093-29106115 ATGAATCAATGAATGAAGCAAGG - Intronic
1189168468 X:38885460-38885482 ATGAATCAGCAGATTCATCAAGG + Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1190110299 X:47585193-47585215 ATCCATCAACAGATGTATAAAGG + Exonic
1193204580 X:78733267-78733289 ATCAATAAAAAGATGAATCTTGG - Intergenic
1194358014 X:92912192-92912214 ATGAATCAATGGAGAAATCACGG + Intergenic
1194826461 X:98570405-98570427 ATGAATCAGCAAATGGACCAAGG - Intergenic
1195014141 X:100761940-100761962 ATGGATCAAAAGATGGCTCATGG - Intergenic
1196280889 X:113822472-113822494 ATGAAAAAACTGATGAATCTAGG - Intergenic
1199120570 X:144048313-144048335 ATCAAGCAACAAATGAATAAAGG + Intergenic
1199156151 X:144551225-144551247 ATGAATCAAATCCTGAATCAGGG - Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200170326 X:154068262-154068284 ATGAATCTACAGTTCAATGAAGG + Intronic
1200666195 Y:6027843-6027865 ATGAATCAATGGAGAAATCACGG + Intergenic