ID: 997895376

View in Genome Browser
Species Human (GRCh38)
Location 5:137711476-137711498
Sequence CCCAACAGGGAGAAGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997895369_997895376 28 Left 997895369 5:137711425-137711447 CCTCATGATTGGCTGACATTCAG 0: 1
1: 0
2: 0
3: 14
4: 133
Right 997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG 0: 1
1: 0
2: 2
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997895376 Original CRISPR CCCAACAGGGAGAAGTGGAC AGG Intronic
900396082 1:2453802-2453824 CCCCACCGGGAGACGGGGACAGG - Intronic
901820521 1:11826321-11826343 CCCGACTGGGAGAAGGGGGCGGG + Intronic
902538951 1:17138817-17138839 CTCAACAGGGAGAGGTGGGGAGG + Intergenic
905453067 1:38069389-38069411 CCCAGCGGGGAGAAGTGCAGTGG + Intergenic
905697861 1:39988853-39988875 CCAATCCGGGAGAACTGGACTGG + Intergenic
905774694 1:40661000-40661022 CCCAAGAGGAAGAAGTGCAGTGG - Intronic
907428458 1:54396471-54396493 CTTAACAGGGAGAAGTGGCAGGG - Intronic
908306407 1:62823521-62823543 CCAAAAAGGGAAAAGAGGACAGG - Intronic
909272893 1:73646477-73646499 CCAAACAGAGTGAAGTAGACAGG + Intergenic
909481459 1:76132032-76132054 CCCACAAGGGAGGAGTGGAATGG - Intronic
909527645 1:76644696-76644718 TCCAAAAGGGAGAAATGGGCCGG + Intergenic
912649484 1:111425203-111425225 CCCACCATGGAGAAGAGGCCAGG + Intronic
913463182 1:119111556-119111578 TCCAGCAGGGAGAAGGGGAAAGG - Intronic
915171632 1:153982175-153982197 CCCTAGAGGGAGAAGGGCACAGG + Exonic
915305097 1:154972746-154972768 CCCAACTGGGAGGAGGGGACAGG + Intronic
919481662 1:198097592-198097614 CACAACATTGAGAAGTGGAAGGG + Intergenic
920439002 1:205966183-205966205 TCCAGGAGGGAGAAGTGGACTGG + Intergenic
920518372 1:206603302-206603324 GCCAACAGGCAGGAGTGGCCAGG + Intronic
920563636 1:206957074-206957096 CCCAACAGGGTTAAGGGTACAGG - Intergenic
920564147 1:206960393-206960415 CCCAACCGGGAGAAGGTGCCTGG + Intronic
922185603 1:223271567-223271589 CCCAACAAGGGGAAGAGGCCAGG + Intronic
924510158 1:244723367-244723389 CCAAACAGGGAGATGTAGATGGG - Intergenic
1062833932 10:623863-623885 CCCAACAGTGAGAAGTGAGGTGG + Intronic
1062988205 10:1789826-1789848 CCCTGGAGGGAGAAGTGGAGGGG - Intergenic
1063503417 10:6575204-6575226 ACCCACAGGGAGATGTGGTCAGG - Intronic
1065847400 10:29757439-29757461 CCCTCCAGTGAGAAGTGGGCTGG - Intergenic
1066260400 10:33724206-33724228 CCCATCATGCAGGAGTGGACAGG + Intergenic
1066271241 10:33826022-33826044 CCCCACTGGGAGTATTGGACAGG + Intergenic
1066413115 10:35192921-35192943 CAAAAGAGGGAGAAGTGGAGAGG - Intronic
1066454571 10:35561718-35561740 TCCAACAGTGAGAACTTGACTGG + Intronic
1067423571 10:46182499-46182521 TCCAACAGTAAGAAGAGGACTGG - Intergenic
1071644321 10:87346037-87346059 TCCAACAGTAAGAAGAGGACTGG + Intergenic
1073154995 10:101339292-101339314 CCCAACATGGAGATGTGCAAAGG - Intergenic
1074908639 10:117887145-117887167 CCCAGGAGGGAGAAGGGGAGAGG - Intergenic
1075141424 10:119840220-119840242 CTCAAGAAGCAGAAGTGGACTGG - Intronic
1075351266 10:121726889-121726911 CTCCTCAGGAAGAAGTGGACCGG - Intergenic
1076186885 10:128457284-128457306 CCCTCCAGTGAGAAGAGGACCGG - Intergenic
1078912724 11:15748052-15748074 CCCAAGAGGGAGAAGTCAATTGG + Intergenic
1080681208 11:34477865-34477887 ACAAACAGGCAGAAGTGGGCAGG - Intergenic
1084121443 11:67071414-67071436 CCCTAGAGGGAGAGGTGGATGGG - Exonic
1085205110 11:74726990-74727012 CCTGCCAGGGAGGAGTGGACAGG - Intronic
1085303272 11:75471213-75471235 CCCAAAAGGGAGAGATGGGCAGG + Intronic
1085680975 11:78574687-78574709 CCCAACGGGGCGGAATGGACAGG + Exonic
1087859199 11:103132864-103132886 CCTAACAGGGAGGAGTCAACAGG - Intronic
1090084829 11:123641738-123641760 CCCTGCTGGGAGAAGGGGACAGG - Intronic
1090250372 11:125246780-125246802 CCTAAGAGGGAAAAGTAGACAGG - Intronic
1090709223 11:129371398-129371420 CCAACCAGAGAGAAGGGGACAGG - Intergenic
1091160617 11:133416379-133416401 TCCTACAGGCAGAGGTGGACTGG - Intronic
1092055324 12:5504089-5504111 CCCAACAAGGAGAGGTGGGGAGG + Intronic
1095937679 12:47703668-47703690 ACTAACAGGGAGGAGTGGGCAGG + Intronic
1096755073 12:53792532-53792554 CCCAACAGGAAGCAGTGGTGGGG - Intergenic
1099147540 12:79065388-79065410 CCCAAAAGAGAGGAGTGGAGGGG + Intronic
1100241760 12:92716686-92716708 CCCAAAAGGGAGAAATGTACTGG - Intergenic
1100631716 12:96396177-96396199 GCCAACAGGGAGAGGCAGACAGG + Intronic
1102435488 12:112919513-112919535 CCCCACAGGCAGAAGAGGACTGG + Exonic
1104026421 12:125030177-125030199 CCCATCAGGGAGAAGTTATCAGG - Exonic
1105252451 13:18711967-18711989 AGCAACAGGGAGGAGAGGACAGG - Intergenic
1110564846 13:76947659-76947681 ACCAACAGGGTGAAGTGGAAGGG + Intergenic
1110804280 13:79736479-79736501 CCCAGTAAGGAGAAGTGGATTGG + Intergenic
1114602664 14:23969284-23969306 CCCAACACTGAGAAATGAACAGG - Intergenic
1114607032 14:24006413-24006435 CCCAACACTGAGAAATGAACAGG - Intergenic
1117479168 14:56125913-56125935 CCCCACATGGAGATGTGGCCAGG + Intronic
1118455417 14:65941828-65941850 CCAAACAGGGAGAAGTGTGCTGG + Intergenic
1119400320 14:74358388-74358410 CCCAAAAGGCAGAAGGTGACAGG - Exonic
1122782507 14:104149637-104149659 GGCAACAGGGAAAAGGGGACAGG - Intronic
1124905042 15:33860329-33860351 CCAACCAGGGAGAAGTAGAAAGG + Intronic
1126558049 15:50011855-50011877 CCCAACAAGTTGAGGTGGACAGG + Intronic
1127776780 15:62270207-62270229 CCCAACAGGGAGGAGTTGTTGGG - Intergenic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1128127952 15:65206826-65206848 CTCAACAGGGAGCAGCGGCCTGG - Exonic
1128300165 15:66561716-66561738 CCCACCAAGGAGAGCTGGACAGG - Intronic
1130043315 15:80424268-80424290 CCCAGAAGGGAGACGAGGACAGG + Intronic
1130691287 15:86083645-86083667 TCCAAGGGGGAGAAGTGGACTGG - Intergenic
1132410972 15:101578089-101578111 ACCAACAGGTAGAAGAAGACAGG - Intergenic
1132539778 16:503325-503347 GCCAGCTGGGAGGAGTGGACTGG + Intronic
1133061117 16:3175142-3175164 CCCACCAGGGGGAGGTGGGCTGG - Intergenic
1133538273 16:6723011-6723033 CCCATCAGAGATAAGTGGAAAGG + Intronic
1133904500 16:10009560-10009582 ACAAACAGGGAGACCTGGACAGG + Intronic
1136030500 16:27499355-27499377 CCCAGCAGGGAGAGGTGGAGTGG + Intronic
1138329692 16:56203818-56203840 ACCACCAGGGAGTAGTGGGCAGG + Intronic
1141483073 16:84319610-84319632 GCTTACAGGGAGAAGGGGACTGG - Intronic
1141751741 16:85962782-85962804 CCCAAGAGAGAGAACGGGACAGG - Intergenic
1141869243 16:86773316-86773338 GCCAGCAGGGAGGAGAGGACTGG + Intergenic
1142703902 17:1682129-1682151 CCCCACTGGGAGATGTAGACAGG + Exonic
1144643482 17:16952627-16952649 CCCATCAGGGACAAGAGGCCGGG - Intronic
1146656222 17:34636746-34636768 GCCAACAGGCAGAAGTGGGGAGG + Intronic
1146996938 17:37329342-37329364 CCTAGCAGGTAGAAGTGGCCAGG + Intronic
1148331835 17:46818129-46818151 CCCAAAATGGAGAAGAGGAGTGG + Intronic
1148551437 17:48552653-48552675 CACAAGGGGGAGAAGAGGACTGG + Exonic
1148679088 17:49462977-49462999 CCCAACAGGTTGAATTGGAATGG + Intronic
1149338967 17:55666969-55666991 AACAACAGGGATAAGTGGGCTGG + Intergenic
1150004926 17:61463559-61463581 CCCAGCAGGGAGAAGGAGAGGGG + Intronic
1151214917 17:72570873-72570895 CCAAAAAGAGACAAGTGGACCGG + Intergenic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1152359677 17:79825873-79825895 CCCAGCAGGAAGAACTAGACAGG - Intergenic
1152444073 17:80330476-80330498 GCCAAGAGGGAGAAGCGGGCTGG + Intronic
1153807809 18:8724670-8724692 CCCAACAGGGAGCCGGGGATGGG - Intronic
1156506542 18:37599412-37599434 CACCACAGGGAGAAGTCCACTGG + Intergenic
1160225707 18:77009273-77009295 CCACACAAGGAGAAGAGGACAGG + Intronic
1160732058 19:645789-645811 CCCAACAGAGAGGAGCGGCCTGG + Intergenic
1161516216 19:4698075-4698097 CCCAACAGGGGCAGGTGGGCTGG + Intronic
1161865234 19:6828363-6828385 CCCCGCAGGGAGAAGGGGAGGGG + Intronic
1162874164 19:13608554-13608576 TGCAACAGGGAGAAGGGGAGGGG - Intronic
1163144920 19:15373676-15373698 CCCAAGAGGGAGGCGGGGACAGG + Intronic
1164814412 19:31183781-31183803 CCCAAAAGGAAGAGGTGAACAGG + Intergenic
1164969734 19:32521402-32521424 GTAAAGAGGGAGAAGTGGACAGG - Intergenic
1165258031 19:34591835-34591857 CCCAACAGGGAAATGTGATCAGG - Intergenic
1165264400 19:34647803-34647825 CCCAACAGGGAAATGTGATCGGG + Intronic
1166785559 19:45364713-45364735 ACCAACAGGGAGATGCAGACAGG + Intronic
927985746 2:27409379-27409401 CCCAACACGGTGAAGTGCTCCGG - Exonic
934487176 2:94725963-94725985 AGCAACAGGGAGGAGAGGACAGG - Intergenic
934943089 2:98516463-98516485 CCCTGCAGGGAGAGGTGGAAAGG + Intronic
935045894 2:99482118-99482140 ACCTCCAGGGAGAAGGGGACTGG + Intronic
935361671 2:102250965-102250987 CCCAAGACGGGGTAGTGGACGGG + Intergenic
935588928 2:104827279-104827301 CGAAATAGGGAGAAGGGGACCGG + Intergenic
937155480 2:119715854-119715876 CCCCAGAGGGAGAAGCAGACGGG + Intergenic
939976192 2:148719962-148719984 CCCCACAAGGAGGAGTGGATTGG + Intronic
943308745 2:186300408-186300430 GGAAACAGAGAGAAGTGGACAGG + Intergenic
946599041 2:221339333-221339355 CCCAGCAGGGAGCAGTGACCTGG + Intergenic
946608226 2:221429973-221429995 CCCAACAGCTTGAAGAGGACAGG - Exonic
946849363 2:223890068-223890090 CCCCATAGGTAGAAGTGGATAGG - Intronic
947984540 2:234437316-234437338 ACCCACAGGGAGAAGAGGCCAGG - Intergenic
948127707 2:235576885-235576907 CCCAACAGGGAGCAATGGAGAGG - Intronic
948933174 2:241145207-241145229 ACAAACAGGGAGAAGTCGGCCGG - Intronic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1170750767 20:19142710-19142732 CCCAAAAGGGAAAAATGAACTGG - Intergenic
1170953785 20:20959736-20959758 CCCAACTGGGAGATGAGTACAGG + Intergenic
1172997036 20:39078534-39078556 CCCAGCAGGGAGGAGCTGACAGG - Intergenic
1173590224 20:44219337-44219359 TCCAACAGGGAGAAAAGGACAGG - Intergenic
1173733557 20:45344549-45344571 CCCAACAGGGAGATGGGGCTGGG + Intronic
1175319261 20:58073805-58073827 CTCAACAGCAAGAAGAGGACAGG + Intergenic
1175493666 20:59396599-59396621 GCCAACAGAGAGAAGTGGACAGG - Intergenic
1179377124 21:40860404-40860426 CCAAACAGGGAAAAGAGAACTGG - Intergenic
1183950047 22:41347702-41347724 CCCCACAGGGAGCATTGGCCTGG + Intronic
1184226691 22:43132843-43132865 TCCAAGGGGGAGAAATGGACTGG + Exonic
1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG + Intronic
1184901339 22:47448365-47448387 CCCCACAGGGAGATGTGCACAGG + Intergenic
949760253 3:7462753-7462775 CACAATGGGGAGAACTGGACAGG - Intronic
950388060 3:12675379-12675401 CCCTACATGGACAAGTCGACTGG + Intergenic
954305441 3:49723110-49723132 CCCAGCTGGGGGAAGGGGACAGG + Exonic
957459083 3:80494260-80494282 CCCAACACTGGGACGTGGACAGG + Intergenic
959154742 3:102653210-102653232 CCCAACAGTTTGAAGTGGCCCGG - Intergenic
961567806 3:127776107-127776129 CCCATGAGGGAGAGGTGCACGGG - Intronic
962867700 3:139461220-139461242 GGCAGCAGGGAGAAGTGGAGAGG - Intronic
963283600 3:143411828-143411850 CCCAACAGGCAGACCTGTACAGG - Intronic
963931054 3:151004698-151004720 CCCAACAGAGAGAAATAGACAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967751882 3:193124491-193124513 CCCAAGAAGGAGAAATGGAAAGG + Intergenic
968985022 4:3870311-3870333 CCCAATGGGGAGGAGTGGAGGGG - Intergenic
969656531 4:8501897-8501919 CTCAACAGAGAGATGTGGGCAGG - Intergenic
969707394 4:8819233-8819255 CCCAAGAGGGAGAAGGGGCAGGG + Intergenic
970094688 4:12449606-12449628 TACAACAGGGAAATGTGGACGGG + Intergenic
971040837 4:22750357-22750379 ATCTACAGGGAGAAGTGGAGAGG - Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
979084619 4:116391053-116391075 CCCATCAGGTGGAAGTGGACAGG - Intergenic
987416010 5:17662930-17662952 CCCCACAAGGAGCAGTGGATTGG + Intergenic
993818930 5:92589903-92589925 GCCACAAGGGAGAAGTGGGCTGG + Intergenic
995820689 5:116227566-116227588 CCCCACAGGTAATAGTGGACGGG - Intronic
996074196 5:119170308-119170330 CCTAACAGGAAAAAGTGGACTGG + Exonic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
998847847 5:146328118-146328140 TCTAACAGGGAGGAGGGGACTGG + Intronic
1001029801 5:168253954-168253976 CCCAACAGGGAGAAAGGGATAGG - Intronic
1002912356 6:1499751-1499773 CCCAACAGGGAAATTTGAACAGG - Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003472755 6:6452267-6452289 CCCAATTGGGAGAAAGGGACAGG - Intergenic
1005510701 6:26509256-26509278 CCCAACAGGAAGAAACAGACTGG - Exonic
1006379543 6:33689509-33689531 CCCAACAGAGAGGAGGGGATGGG - Intronic
1007106909 6:39289821-39289843 CCAGACAGGGGGAAGTGGAAAGG - Intergenic
1007703133 6:43775825-43775847 CCTCACAGGAAGCAGTGGACTGG + Intronic
1008237713 6:49070165-49070187 CCAAAGAGGGAAAAGAGGACTGG + Intergenic
1009401637 6:63263053-63263075 TCCAACAGGGAGCAGGGAACTGG + Intergenic
1013372453 6:109482949-109482971 CCCAGCAGGGAGAGGTGGCGCGG + Intronic
1015413627 6:132922909-132922931 CCCAAAAGGGAGAAGAGTATGGG + Intergenic
1019684382 7:2372858-2372880 CCCAACAGTGAGCATTTGACTGG + Intronic
1021446231 7:20736623-20736645 CCTAACTGGGAGAAATGTACAGG - Intronic
1025829394 7:65036718-65036740 ACCAAGAGGTGGAAGTGGACAGG + Intergenic
1027198500 7:76047851-76047873 CCCAAGAGGTGGAAGAGGACGGG - Exonic
1036714451 8:11107537-11107559 ACCAGCAGGGAGAAGTGGTGAGG + Intronic
1037524758 8:19713861-19713883 CCCCAGATGGAGAAGGGGACTGG + Intronic
1038527426 8:28288352-28288374 CCCAGCAGAGAGAAAGGGACGGG + Intergenic
1042844804 8:73159086-73159108 CCCCACATGGAGGAGTGGGCTGG + Intergenic
1049742276 8:144246942-144246964 CCCAAATGGGAGGAGTGCACGGG - Intronic
1050584484 9:7096451-7096473 CCAAACAGATAGAAGTGAACGGG - Intergenic
1051447327 9:17154578-17154600 CCCAACTGGGAGATATTGACAGG + Intronic
1051674713 9:19547346-19547368 CTGCACAGGGAGCAGTGGACTGG + Intronic
1053123086 9:35560590-35560612 CCCGAGAGGGAGTAGTGGAGGGG + Exonic
1053358328 9:37465476-37465498 CCCAACTGGGAGAGGCGGAATGG - Intergenic
1053670625 9:40358388-40358410 AGCAACAGGGAGAAGAGGACAGG + Intergenic
1053920414 9:42984733-42984755 AGCAACAGGGAGGAGAGGACAGG + Intergenic
1054381746 9:64498451-64498473 AGCAACAGGGAGAAGAGCACAGG + Intergenic
1054513988 9:66017912-66017934 AGCAACAGGGAGAAGAGGACAGG - Intergenic
1057798141 9:98172579-98172601 CCCCACAGCGGGAAGTGGATGGG + Intronic
1058017671 9:100054143-100054165 CCCATCAGGGATAAGAGGATGGG + Intronic
1058767448 9:108195667-108195689 CCCAATAGGCAGAACTGTACAGG + Intergenic
1060670459 9:125464658-125464680 CCTAAGAGGGAGAAGTCGAGGGG + Intronic
1060677455 9:125528384-125528406 GCAGGCAGGGAGAAGTGGACAGG - Intronic
1062005735 9:134237612-134237634 CCCAGGAGGGAGAAAGGGACTGG + Intergenic
1062393705 9:136344119-136344141 CCCAACAGGGAGGTGCGGACAGG + Intronic
1186286072 X:8045367-8045389 CCCAGCTGGGAGAAGTGGTAAGG + Intergenic
1187447383 X:19371691-19371713 CCCACCAGGGAGAAGGGGCCAGG - Intronic
1189425934 X:40899996-40900018 CCCAGCAGGGATAAATGTACTGG - Intergenic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1191027842 X:55934805-55934827 ACCAAGGGGGAGAAGTGGACAGG - Intergenic
1193149809 X:78113256-78113278 CCCAACAGGCTGGAGTGGAGAGG - Intronic
1194467252 X:94248216-94248238 CCAAAAAGGGAGAAGGTGACAGG + Intergenic
1195278518 X:103307830-103307852 ACCAAAGGGGAAAAGTGGACAGG - Intergenic
1201273519 Y:12278267-12278289 CCAAACAGGGAGGACTGGAAGGG + Intergenic