ID: 997899844

View in Genome Browser
Species Human (GRCh38)
Location 5:137754365-137754387
Sequence GAGGGTGCGCGCGCGTTCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997899844_997899854 17 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899844_997899853 16 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899853 5:137754404-137754426 CCGCCGACGTACGGCAGCCTAGG 0: 1
1: 0
2: 1
3: 1
4: 45
997899844_997899851 7 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899851 5:137754395-137754417 CGTGCGTCACCGCCGACGTACGG 0: 1
1: 0
2: 0
3: 0
4: 4

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997899844 Original CRISPR GAGGGTGCGCGCGCGTTCAG CGG (reversed) Exonic