ID: 997899844

View in Genome Browser
Species Human (GRCh38)
Location 5:137754365-137754387
Sequence GAGGGTGCGCGCGCGTTCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997899844_997899851 7 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899851 5:137754395-137754417 CGTGCGTCACCGCCGACGTACGG 0: 1
1: 0
2: 0
3: 0
4: 4
997899844_997899853 16 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899853 5:137754404-137754426 CCGCCGACGTACGGCAGCCTAGG 0: 1
1: 0
2: 1
3: 1
4: 45
997899844_997899854 17 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997899844 Original CRISPR GAGGGTGCGCGCGCGTTCAG CGG (reversed) Exonic
901796140 1:11680807-11680829 GAGGGGGCGCGGGCGGCCAGTGG - Intronic
902616380 1:17625746-17625768 GAGGGTGCGCGGCCATGCAGGGG + Intronic
1066963632 10:42242439-42242461 GCGGGTGCGCGCGCGGTTGGGGG - Intergenic
1072782107 10:98258137-98258159 GAGGGTGCGCCTGCGCTCCGGGG - Exonic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1083256184 11:61496715-61496737 GAGAGTGCGAGCGCGCTCACGGG - Intergenic
1096710630 12:53452627-53452649 GAGGGCGCGCGCGCGGTAGGGGG + Intronic
1107708344 13:43128794-43128816 GATGGTGGGCGCGTGTGCAGCGG - Intergenic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1130270646 15:82445268-82445290 CAGGGGGCGCGCGGGTTGAGGGG + Intergenic
1130462990 15:84172591-84172613 CAGGGGGCGCGCGGGTTGAGGGG + Intronic
1130489684 15:84422197-84422219 CAGGGGGCGCGCGGGTTGAGGGG - Intergenic
1130501275 15:84500959-84500981 CAGGGGGCGCGCGGGTTGAGGGG - Intergenic
1131268961 15:90935170-90935192 GAGGGAGCGCGCCCGGGCAGGGG - Intronic
1133004979 16:2875031-2875053 GAGGGCGCGCGCGGACTCAGCGG + Intergenic
1133009686 16:2904345-2904367 GAGGGCGCGCGCGGACTCAGCGG + Intergenic
1136719749 16:32310533-32310555 GGGGGCGCGCGCGCGGTTAGCGG - Intergenic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1139597810 16:67968420-67968442 GACGGTGAGGGCGCGTTCTGAGG - Exonic
1141839755 16:86567130-86567152 GCAGGGGCGCGCGCTTTCAGCGG - Intergenic
1203006682 16_KI270728v1_random:207236-207258 GGGGGCGCGCGCGCGGTTAGCGG + Intergenic
1203148295 16_KI270728v1_random:1817093-1817115 GGGGGCGCGCGCGCGGTTAGCGG - Intergenic
1147524817 17:41212670-41212692 GAGGGTGCACTCCTGTTCAGAGG - Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160505230 18:79423096-79423118 GAGGGTTGGGGCGCGTACAGAGG + Intronic
931496915 2:62817750-62817772 GAGAGTGTGTGCGTGTTCAGAGG + Intronic
939322985 2:140648606-140648628 GAGGGTGGGGCCGGGTTCAGGGG + Intronic
944494906 2:200296895-200296917 GTGCGTGCGCGCGCATTCAGGGG - Intergenic
1173165955 20:40687696-40687718 GCGGGTGCGCGGGCGGGCAGGGG - Exonic
1180141482 21:45896031-45896053 CAGGGTGCACGGGAGTTCAGGGG - Intronic
1180739702 22:18044599-18044621 GAGGGTGCACGGGAGGTCAGTGG + Intergenic
960702258 3:120450600-120450622 GCGGGTGGGCGCGCGTCCTGGGG - Intronic
961365159 3:126394979-126395001 GTGGGTGCGCTCGCGGTCCGGGG + Intronic
969781784 4:9409912-9409934 CAGGGTGGGCGCGGGCTCAGCGG - Intergenic
975710598 4:77157304-77157326 GAGGGTGGGCGCGCGGGGAGCGG + Exonic
985537425 5:473104-473126 GAGTGCGCACGCGCGTTCGGCGG - Intergenic
995965541 5:117903137-117903159 GGGGGTGGGGGGGCGTTCAGAGG + Intergenic
997899844 5:137754365-137754387 GAGGGTGCGCGCGCGTTCAGCGG - Exonic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG + Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG + Intergenic
1022230750 7:28410064-28410086 GCGGGTGGGCGCGCGCGCAGGGG + Intronic
1025194798 7:56924410-56924432 GAGGGGGCGCACGGGTGCAGTGG - Intergenic
1025677154 7:63652533-63652555 GAGGGGGCGCACGGGTGCAGTGG + Intergenic
1026817325 7:73522668-73522690 GAGGGTGAGCGCGCGGCCAGGGG + Intergenic
1029238636 7:99143516-99143538 GAGGGGGCGCGAGCGGCCAGGGG + Intronic
1029672778 7:102045427-102045449 GAGGGGGCGCGCGGGCGCAGTGG - Intronic
1031982305 7:128135844-128135866 GAGGGGGCGCGCGAGCTCGGCGG + Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1039949028 8:42153357-42153379 GAAGGGGCACGCGCGTTCCGGGG - Intronic
1045674090 8:104589057-104589079 GAGGGAGCGCGCGCGGGCGGCGG - Intergenic
1059191807 9:112333746-112333768 GAGGGTGGGCGCGAGCGCAGGGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1200233542 X:154457987-154458009 GCGGGCGCGCGCGGGTTCCGGGG + Intergenic