ID: 997899851

View in Genome Browser
Species Human (GRCh38)
Location 5:137754395-137754417
Sequence CGTGCGTCACCGCCGACGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 4}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997899843_997899851 20 Left 997899843 5:137754352-137754374 CCACACAAAGAGGCCGCTGAACG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 997899851 5:137754395-137754417 CGTGCGTCACCGCCGACGTACGG 0: 1
1: 0
2: 0
3: 0
4: 4
997899844_997899851 7 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899851 5:137754395-137754417 CGTGCGTCACCGCCGACGTACGG 0: 1
1: 0
2: 0
3: 0
4: 4

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997899851 Original CRISPR CGTGCGTCACCGCCGACGTA CGG Intergenic