ID: 997899851 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:137754395-137754417 |
| Sequence | CGTGCGTCACCGCCGACGTA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 4} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 997899843_997899851 | 20 | Left | 997899843 | 5:137754352-137754374 | CCACACAAAGAGGCCGCTGAACG | 0: 1 1: 0 2: 0 3: 5 4: 66 |
||
| Right | 997899851 | 5:137754395-137754417 | CGTGCGTCACCGCCGACGTACGG | 0: 1 1: 0 2: 0 3: 0 4: 4 |
||||
| 997899844_997899851 | 7 | Left | 997899844 | 5:137754365-137754387 | CCGCTGAACGCGCGCGCACCCTC | 0: 1 1: 0 2: 0 3: 2 4: 53 |
||
| Right | 997899851 | 5:137754395-137754417 | CGTGCGTCACCGCCGACGTACGG | 0: 1 1: 0 2: 0 3: 0 4: 4 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 997899851 | Original CRISPR | CGTGCGTCACCGCCGACGTA CGG | Intergenic | ||