ID: 997899854

View in Genome Browser
Species Human (GRCh38)
Location 5:137754405-137754427
Sequence CGCCGACGTACGGCAGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 8}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997899849_997899854 -6 Left 997899849 5:137754388-137754410 CCCGAGGCGTGCGTCACCGCCGA 0: 1
1: 0
2: 0
3: 0
4: 21
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899850_997899854 -7 Left 997899850 5:137754389-137754411 CCGAGGCGTGCGTCACCGCCGAC 0: 1
1: 0
2: 0
3: 3
4: 26
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899846_997899854 -1 Left 997899846 5:137754383-137754405 CCCTCCCCGAGGCGTGCGTCACC 0: 1
1: 0
2: 0
3: 13
4: 70
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899844_997899854 17 Left 997899844 5:137754365-137754387 CCGCTGAACGCGCGCGCACCCTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899843_997899854 30 Left 997899843 5:137754352-137754374 CCACACAAAGAGGCCGCTGAACG 0: 1
1: 0
2: 0
3: 5
4: 66
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899847_997899854 -2 Left 997899847 5:137754384-137754406 CCTCCCCGAGGCGTGCGTCACCG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8
997899848_997899854 -5 Left 997899848 5:137754387-137754409 CCCCGAGGCGTGCGTCACCGCCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 0
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997899854 Original CRISPR CGCCGACGTACGGCAGCCTA GGG Intergenic