ID: 997900374

View in Genome Browser
Species Human (GRCh38)
Location 5:137758015-137758037
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997900371_997900374 20 Left 997900371 5:137757972-137757994 CCAGTTTACTCCATAATCTAGTT No data
Right 997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG No data
997900373_997900374 10 Left 997900373 5:137757982-137758004 CCATAATCTAGTTTTGGTTGCTG No data
Right 997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr