ID: 997904330

View in Genome Browser
Species Human (GRCh38)
Location 5:137800123-137800145
Sequence ATCCTGCTGGGTCACTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997904330_997904335 22 Left 997904330 5:137800123-137800145 CCCAGCCAGTGACCCAGCAGGAT No data
Right 997904335 5:137800168-137800190 TGTCAATGTTGTTGACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997904330 Original CRISPR ATCCTGCTGGGTCACTGGCT GGG (reversed) Intergenic
No off target data available for this crispr