ID: 997905223

View in Genome Browser
Species Human (GRCh38)
Location 5:137809603-137809625
Sequence AGGCAAACAGCAGTGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 1, 3: 126, 4: 344}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997905219_997905223 23 Left 997905219 5:137809557-137809579 CCGCCATCATTTGTGGCAAAGAA 0: 1
1: 0
2: 2
3: 37
4: 444
Right 997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG 0: 1
1: 0
2: 1
3: 126
4: 344
997905218_997905223 24 Left 997905218 5:137809556-137809578 CCCGCCATCATTTGTGGCAAAGA 0: 1
1: 0
2: 0
3: 28
4: 280
Right 997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG 0: 1
1: 0
2: 1
3: 126
4: 344
997905217_997905223 28 Left 997905217 5:137809552-137809574 CCTGCCCGCCATCATTTGTGGCA 0: 1
1: 0
2: 0
3: 1
4: 74
Right 997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG 0: 1
1: 0
2: 1
3: 126
4: 344
997905220_997905223 20 Left 997905220 5:137809560-137809582 CCATCATTTGTGGCAAAGAATGA 0: 1
1: 0
2: 1
3: 23
4: 210
Right 997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG 0: 1
1: 0
2: 1
3: 126
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997905223 Original CRISPR AGGCAAACAGCAGTGATGGC TGG Intergenic
901241198 1:7694692-7694714 AGGGAGACAGCAGAGAGGGCCGG - Intronic
902671822 1:17979959-17979981 AGCCAATCAGCAGTGGAGGCGGG + Intergenic
902907086 1:19566340-19566362 AAATAAACAGCAGGGATGGCCGG + Intergenic
903238594 1:21967340-21967362 AGGCAAACTCCTATGATGGCAGG + Intergenic
903298397 1:22360658-22360680 AGGCAACAGGCAGTGGTGGCAGG + Intergenic
903376869 1:22872051-22872073 AAGCTAAAAGCAGTGTTGGCAGG + Intronic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908079698 1:60563022-60563044 AGGCAAGCAGCGGTGACTGCCGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
912749262 1:112272180-112272202 AGGCAAACAGCAAAGAAAGCTGG + Intergenic
913218604 1:116641662-116641684 AGGCAGAGAGCAGAGCTGGCAGG + Intronic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914044052 1:144077037-144077059 AGGCAAAAAGCTGCGGTGGCGGG - Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
914327108 1:146629911-146629933 AGGCTAAAATCAGTGTTGGCAGG + Intergenic
914422898 1:147545492-147545514 AGCCAGACAGCAGTGATAACAGG + Intronic
915129701 1:153687969-153687991 GGGCAACCAGCTGAGATGGCAGG - Intronic
917021735 1:170595887-170595909 AGGCAAACAGAAAGGATGGTAGG + Intergenic
917139155 1:171817539-171817561 AAGCAAAGTGCAGTGCTGGCTGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917706928 1:177644259-177644281 AGGCAAAAAGAAGTGATGTAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919169839 1:193939529-193939551 AGGCCAACAGGAGTGCTGCCAGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920809316 1:209267544-209267566 AAGAAAACAGCAGTGATGCCAGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924208710 1:241742886-241742908 AGTCATCCGGCAGTGATGGCTGG + Intronic
1062823979 10:555550-555572 AAGCAAACAGAAGAGAAGGCAGG + Intronic
1063042697 10:2359321-2359343 AGGCAGCCAGCAGAGAGGGCTGG + Intergenic
1063385084 10:5611327-5611349 TGGCACACAGCAGGGAGGGCTGG + Intergenic
1063984220 10:11483696-11483718 AGGCAAAAGGCAGTGTTGGGGGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065239272 10:23688880-23688902 AGGCAAAAAGCAGGGAAGCCAGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066294307 10:34040998-34041020 AGCCACACAGCAGGGAAGGCCGG + Intergenic
1066780663 10:38942301-38942323 GGGCAAAAAGCAGCGACGGCGGG - Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1067509277 10:46881920-46881942 CAGAAAACAGCGGTGATGGCAGG + Intergenic
1067652975 10:48169935-48169957 CAGAAAACAGCGGTGATGGCAGG - Intronic
1068153932 10:53170870-53170892 AGGCAAACAGTAATGATGAAAGG + Intergenic
1068304274 10:55183829-55183851 AGGCTAACAGAAGTGATGCAAGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070205177 10:74251860-74251882 AGGAAAACAGCAGTAATGAATGG - Intronic
1070954829 10:80456764-80456786 TTGAAAACAGCTGTGATGGCTGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG + Intronic
1074119055 10:110479759-110479781 AGGCAAAAACCAGGGGTGGCTGG - Intergenic
1074428310 10:113371456-113371478 AGGGAAACAGGAGTGATCTCAGG - Intergenic
1074974488 10:118569091-118569113 AGGAAAACAGCACTGAAGACGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075052169 10:119190608-119190630 AGTCAATAAGCAGTGCTGGCAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077780641 11:5325289-5325311 ACAGAAACAGTAGTGATGGCTGG - Intronic
1077844586 11:6011768-6011790 AGGCACAGAGCAGTGAGGGGTGG + Intergenic
1079050384 11:17151290-17151312 ACGATAACAGCAGTGCTGGCTGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079779849 11:24587816-24587838 AGGCAAACAGCTGTGGTGAGAGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083579480 11:63815629-63815651 TGGGAAACTCCAGTGATGGCAGG + Intronic
1084599679 11:70137426-70137448 CAGCAGACAGCGGTGATGGCGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085340173 11:75726187-75726209 AGGCAAGCTGCTGCGATGGCTGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086579317 11:88379139-88379161 AGGAAAACAACAGGGTTGGCAGG - Intergenic
1087568711 11:99896221-99896243 TGGCAGAGAGCAGTGAAGGCAGG - Intronic
1087635200 11:100694493-100694515 ATTCATACAGCAGGGATGGCTGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088547417 11:110973845-110973867 AGGCAGAGAGCAGTGTAGGCTGG - Intergenic
1088706349 11:112467759-112467781 AGGGACACAGCAGGGAAGGCAGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089010019 11:115124530-115124552 ACGCAAACAGCAGGGAAAGCAGG - Intergenic
1089173866 11:116534721-116534743 TGGCACACAGCAGAGAAGGCAGG + Intergenic
1089220719 11:116869244-116869266 TGGCAAACAGGGGTGTTGGCAGG - Intronic
1090252827 11:125263392-125263414 AGGCAAACAGCAGGGACTGCTGG + Intronic
1090711138 11:129386862-129386884 AGGCAGACAGGAGTGGTGGCAGG - Intronic
1092179921 12:6439445-6439467 AGGCTACAATCAGTGATGGCAGG + Intergenic
1093098502 12:14999223-14999245 AAGAAAACAGCAGGGATGGGGGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093817115 12:23562275-23562297 AGGGAAAGAGCAGTTGTGGCAGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098071100 12:66675586-66675608 AGGTAAACAGCTGTGAAGGTAGG + Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099778346 12:87163026-87163048 AGGCAGACAGCTGTGGGGGCAGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104066027 12:125306663-125306685 AGGCAAGCAACAATAATGGCTGG - Intronic
1104328665 12:127824084-127824106 AGGTAAACAGGACTGATGGAAGG - Intergenic
1105533631 13:21243508-21243530 AGGCAGAAAGCAGAGATGGGAGG + Intergenic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108413631 13:50175511-50175533 AAGAGAACAGCAGTGATGACAGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110808804 13:79789589-79789611 AGCCAAACAGCAGAGATAGAAGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111494872 13:89034691-89034713 AGGCAAACAGATGTCATGGGTGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113610403 13:111640740-111640762 AGGCAAAGGGCCGTCATGGCTGG - Intronic
1113909986 13:113837114-113837136 AGGGATAGAGCAGTGATGGGAGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114873929 14:26691827-26691849 GGGGAAAGAGCAGTCATGGCTGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115521717 14:34239577-34239599 AGGTAAACAAGAGTGATGTCTGG + Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117996756 14:61485018-61485040 AGCCAAACAGAAGTGGAGGCCGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121189525 14:92013542-92013564 AGGCAAAAAGCAATTATGACTGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202940170 14_KI270725v1_random:137876-137898 GGGCAAAAAGCCGCGATGGCGGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124149893 15:27167969-27167991 AGGCGAGCAGAAGTGATGGAGGG + Intronic
1125416710 15:39461326-39461348 ATGCAAACATCTGAGATGGCAGG - Intergenic
1126070397 15:44860894-44860916 AGGGGAGCAGCAGAGATGGCTGG + Intergenic
1126087636 15:45024223-45024245 AGGGGAGCAGCAGAGATGGCTGG - Intronic
1126440116 15:48678577-48678599 AGGCAATCACCAGTCATGGAGGG - Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127466405 15:59248702-59248724 AAGTAAACAGCAGAGATGGGGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128611018 15:69073835-69073857 AGGCAGATAGCAGAGATGGAAGG + Intergenic
1128941486 15:71791192-71791214 AGGAAAACAGCAATGCCGGCTGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132282198 15:100629557-100629579 ATGCAAAAAGCAATGACGGCTGG + Exonic
1132371288 15:101301174-101301196 AGGAAAGCAACAGTGAAGGCTGG + Intronic
1132406756 15:101546381-101546403 AAGCAACAAGCAGTGATGGAGGG + Intergenic
1133737494 16:8627067-8627089 AGGCAAGCAACAGAGGTGGCTGG - Intronic
1136516793 16:30773313-30773335 TGGGAGACAGGAGTGATGGCAGG + Intronic
1136696494 16:32085390-32085412 AGGCAAAAAGCTGCGGTGGCAGG + Intergenic
1136771745 16:32846611-32846633 AGGCAAAAAGCCGTGCCGGCGGG + Intergenic
1136796992 16:33028664-33028686 AGGCAAAAAGCTGCGGTGGCAGG + Intergenic
1136898852 16:34014868-34014890 AGGCAAAAAGCCGTGCGGGCGGG - Intergenic
1137299955 16:47139379-47139401 AGGAAAATAACAGTGGTGGCAGG - Intronic
1137496095 16:48970493-48970515 AGCCAATCACCAGTGCTGGCTGG - Intergenic
1138234821 16:55373410-55373432 AGACAAAGAGCAGGGAAGGCAGG + Intergenic
1138461355 16:57149750-57149772 GGGCAGACAGCAGAGATGGCTGG - Intergenic
1138551435 16:57750987-57751009 AGGCATCCAGCACTGAGGGCCGG - Intronic
1139595681 16:67956919-67956941 AGGCGAACAGTAGTGATTTCAGG + Intronic
1139962031 16:70723697-70723719 AGGCAACCAGCAGGGCTGGTAGG - Intronic
1140006453 16:71081028-71081050 AGGCTAAAATCAGTGTTGGCAGG - Intronic
1140339849 16:74146754-74146776 AGTCAAAGGGCAGTCATGGCTGG + Intergenic
1140861575 16:79023019-79023041 AAGCCAACAGCAGTGAGTGCTGG - Intronic
1141031666 16:80594495-80594517 AGACAAAAGCCAGTGATGGCAGG - Intergenic
1141251956 16:82367397-82367419 AGGCACAGAGCAGTGAGGGTTGG - Intergenic
1141359704 16:83384282-83384304 TGGCAGTCAGCAGAGATGGCTGG - Intronic
1142115446 16:88353887-88353909 AGGCCAACAGCAGGGAGGGGAGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1203074171 16_KI270728v1_random:1108722-1108744 AGGCAAAAAGCCGTGCCGGCGGG + Intergenic
1142870662 17:2818202-2818224 AGGCAAGCAGAAATGATGACCGG - Intronic
1144814691 17:18025761-18025783 AGGAAGTCAGCACTGATGGCTGG - Intronic
1146978295 17:37135349-37135371 TGGCAAACTGGAGTGCTGGCTGG + Intronic
1147054931 17:37826657-37826679 AGGAAAGCAGAAGTGAAGGCTGG - Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152371838 17:79893077-79893099 AGGCCAGCAGCAGTGGGGGCAGG + Intergenic
1152533259 17:80933801-80933823 AGGCATAAAGCAGTGACGGAAGG - Intronic
1152697152 17:81803196-81803218 GGGCACAGAGCAGGGATGGCTGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153748864 18:8209279-8209301 AGGCCAGAGGCAGTGATGGCTGG + Intronic
1154030896 18:10753439-10753461 AGGAAAGCAGCAGGGATGGGTGG - Intronic
1154341969 18:13511021-13511043 AGGAAAACGGCAGTGATTTCTGG + Intronic
1154396296 18:13992973-13992995 AAACAAACAGCAGAGAAGGCCGG - Intergenic
1154518389 18:15198091-15198113 CGGCAAAAAGCCGTGACGGCTGG + Intergenic
1155261207 18:24044263-24044285 AGGCAAAGATCAGTGATGTGGGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156267470 18:35501585-35501607 AGGCAAGCTGGAGAGATGGCAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157815229 18:50725240-50725262 AGGCAGACAGCCTTGATGGATGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1159476090 18:68922605-68922627 AGTCAAGCAGCAGGCATGGCTGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1161702037 19:5800912-5800934 AGGCAAACACCAGAAAGGGCAGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164540097 19:29115607-29115629 AGGGAGCCAGCAGTGAGGGCAGG - Intergenic
1166772150 19:45290308-45290330 AGGCACCCAGCCGTGGTGGCTGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168322463 19:55518276-55518298 AGGGACACAGTAGTGATGACAGG - Exonic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928298237 2:30103996-30104018 TGGCAAACAGTAGTGATGACCGG - Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
928713000 2:34028580-34028602 AGGCAAACAGTAGTGATTTATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934934073 2:98452020-98452042 ATGAAACCGGCAGTGATGGCTGG - Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936019547 2:108984378-108984400 AGGCAAACAGAAGTCAAGTCAGG - Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937916036 2:127099146-127099168 GGGGAGACAGCACTGATGGCTGG - Intronic
938922586 2:136008713-136008735 AAGCATACAGCAATGAAGGCAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939463661 2:142529694-142529716 AGGGAAAAAACAATGATGGCTGG - Intergenic
940652710 2:156453592-156453614 TAGAAAACAGCAATGATGGCCGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945818961 2:214639356-214639378 AGGCAAAGAGCAGTAAAGGAAGG + Intergenic
946409099 2:219507628-219507650 GGGCAAACATGAGAGATGGCTGG - Intergenic
947480383 2:230494052-230494074 AAGAAATCACCAGTGATGGCCGG - Intronic
947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1175758742 20:61546966-61546988 AAGCAGACAGCAGTGATGGGCGG + Intronic
1177239610 21:18440076-18440098 AAGAAAACTGTAGTGATGGCCGG + Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177763507 21:25430246-25430268 AGGCAACCCACAGTGATGGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178505393 21:33158499-33158521 GGGCCAAGGGCAGTGATGGCTGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179944960 21:44666912-44666934 AGGCAGAGGGCAGTGATGTCTGG + Exonic
1179946588 21:44682149-44682171 AGGCAGAGGGCAGTGATGTCTGG + Exonic
1180130834 21:45825973-45825995 AAGAAAAAAGCAGTGAGGGCGGG + Intronic
1185168432 22:49276688-49276710 AGGCACACAGGGGTGATGCCAGG - Intergenic
949212186 3:1516230-1516252 AGGCAACCAGCAGTCCTGGAGGG + Intergenic
949810502 3:8001715-8001737 AGCCACACAGCAGGGATGGCAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
950024864 3:9813273-9813295 AGTCGAACAGCTGTGATGGCTGG - Exonic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951016886 3:17742072-17742094 AGGCCAACTGCAGTAAAGGCAGG - Intronic
951193866 3:19803126-19803148 AGGCAAACAGCTGCCATGACAGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951600880 3:24373465-24373487 AGGCAGCCAGAAGTCATGGCTGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954137062 3:48586798-48586820 AGGGAGTCAGCAGTGATGGCAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956682741 3:71796470-71796492 AGGCACATAGCAGTGATAGGCGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957280295 3:78142881-78142903 TGGCTAACAGCAGGGTTGGCTGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960165668 3:114398477-114398499 AGGGCAATGGCAGTGATGGCGGG - Intronic
960807248 3:121596005-121596027 AGGCAAACAGGGTTGATGTCAGG - Intronic
961386320 3:126525176-126525198 AGGCAAACAGCCCTGAGGTCAGG - Intronic
961677799 3:128578115-128578137 AGGCAAGCAGCCGTGGTGACAGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963459509 3:145591050-145591072 AGGCAATAACAAGTGATGGCAGG + Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964092578 3:152893900-152893922 AGGCAGACAAGACTGATGGCAGG + Intergenic
964432558 3:156622124-156622146 TGGCAAACAGTATTGATGGGTGG - Intergenic
964481998 3:157148722-157148744 GGGCATACAGCAGTGAGGGGTGG - Intronic
965261908 3:166497782-166497804 AGGGAAACAAGAGTGATGACAGG - Intergenic
965779935 3:172274691-172274713 AGTCAGACTGCAGTGTTGGCAGG + Intronic
966240799 3:177753589-177753611 GGGGAAACAGGAGTGAGGGCAGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966750142 3:183313984-183314006 AGGCACACAGCAGGAATGACGGG + Intronic
966803666 3:183788289-183788311 AGGCCAACAGCAGGGAGGGAGGG - Intronic
967091571 3:186138975-186138997 AGGCAAAAATGAGTGATAGCAGG - Intronic
967422808 3:189292817-189292839 TGGCAACGAGCAGAGATGGCTGG + Intronic
967807892 3:193731316-193731338 AAGCAAACAGAAGTGATATCAGG - Intergenic
968359850 3:198139211-198139233 AGGCCATCAGCACTGAAGGCCGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970286114 4:14518049-14518071 AGTCTAACTTCAGTGATGGCAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974270769 4:59649151-59649173 AGGCTTACAGCAATGATGGAAGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975534327 4:75433565-75433587 TTAGAAACAGCAGTGATGGCTGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977271188 4:94919031-94919053 AGGCAAACAGCTGGGATTGTGGG - Intronic
977407247 4:96615632-96615654 AGGGGAACATCATTGATGGCAGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978424466 4:108567685-108567707 AGGAAATCAGCAGTGTTTGCTGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978769907 4:112444190-112444212 GGGCAGAAAGCATTGATGGCTGG + Intergenic
979870061 4:125808025-125808047 AGGCAAACAGGAGTGAAAGAGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981238245 4:142443341-142443363 AGGGGAACAGCAGTAATTGCAGG + Intronic
982325200 4:154122659-154122681 GGACAAACAGCAGAAATGGCTGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984446427 4:179842441-179842463 AGGCACACAGCAATGAAGGGCGG + Intergenic
987115765 5:14725522-14725544 ATGCAAACTGCAGTGCTCGCAGG - Intronic
987872589 5:23640261-23640283 AGGAAAACAGGGGAGATGGCAGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989434147 5:41391542-41391564 AAGTAAACAGCAGTGATATCCGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993806809 5:92420568-92420590 AGGAAAACAGCAGTTAGGGAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994439458 5:99784031-99784053 AGTCCAACATCAGTGTTGGCAGG - Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997293372 5:132753689-132753711 AGGCTAACACCTGTGATGGGAGG + Exonic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
1002047746 5:176551404-176551426 AGGGAAACAACAGTAGTGGCCGG + Intronic
1002182582 5:177438627-177438649 AGGCAAAGAGGAGTGCCGGCAGG + Intronic
1002296082 5:178232209-178232231 AGCCGAACAGCGGTGAGGGCGGG + Intronic
1003377455 6:5593035-5593057 AGGCAGAAAGCAGAGATGGGAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004267972 6:14165814-14165836 GGGCAGTCAGCAGTCATGGCTGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006338715 6:33433982-33434004 AGGCCAACTGGAGAGATGGCCGG - Intronic
1006435235 6:34022654-34022676 AGGCTGCCAGCAGTGATGGCTGG + Exonic
1006490570 6:34383850-34383872 AGGCAAACAGAAGGGAAAGCAGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011067244 6:83340304-83340326 AAGAAAACAGCAGTGATAACGGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016344381 6:143096353-143096375 ATGTAAACAGCAATGAAGGCAGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017988843 6:159469039-159469061 AGGCAAAAAGGAGTGAAGGAAGG + Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018830778 6:167441754-167441776 AGGCAAACAGAAGAAAAGGCGGG - Intergenic
1019085938 6:169476899-169476921 AGACAAACAAGAGTGATGACTGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023119127 7:36891848-36891870 AGACAAACATCAGTGAAAGCAGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024998872 7:55296796-55296818 AGGAACACAGCAGTGAAAGCAGG - Intergenic
1025320136 7:58087036-58087058 GGGCAAAAAGCTGTGGTGGCAGG - Intergenic
1025561111 7:62376441-62376463 GGGCAAAAAGCCGCGATGGCGGG - Intergenic
1025878535 7:65509776-65509798 AGGCAAAAAGCCGCGACGGCAGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026628554 7:72017953-72017975 AGGTTAACAGAAGTGTTGGCTGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028276506 7:88864424-88864446 AGGCAAATGGAAGTGATGCCAGG + Intronic
1028301035 7:89201166-89201188 TGTGAAACTGCAGTGATGGCAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1033882908 7:145908837-145908859 AGACAAAGATCAGTTATGGCTGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034908291 7:154970779-154970801 AGGTAAACAGCAGCGAGGGGTGG + Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1038007484 8:23445095-23445117 AGGTAACCAGCAGTGAGAGCAGG - Intronic
1038941745 8:32312805-32312827 AGGCAAACAGGAAGGATGGAAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040010825 8:42659750-42659772 AGGCAAGCAGCTGAGATGACAGG - Intergenic
1040373336 8:46798168-46798190 TGGGTAACAGCAGCGATGGCTGG - Intergenic
1042022989 8:64390279-64390301 AGGGAAACTGGAGTGAGGGCAGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044914865 8:97102322-97102344 ACTCAAACAGTAGTGATGGTTGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045099030 8:98826147-98826169 GGGCAAACCGTAGTGAGGGCAGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047683261 8:127276932-127276954 AGGAAAACAGTGGGGATGGCAGG + Intergenic
1049001820 8:139831110-139831132 GGGCAAACAGGAGAGAGGGCTGG + Intronic
1049124972 8:140778504-140778526 AGGCAGGCAGCACTTATGGCTGG + Intronic
1049861697 8:144902849-144902871 TGGCACACAGAAGTGCTGGCGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051736286 9:20202498-20202520 TGGGAAAAAGCAGTTATGGCGGG + Intergenic
1053084619 9:35208174-35208196 GAACAAACAGCAGGGATGGCAGG - Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053354829 9:37436781-37436803 AGCCAAACAGTAGAGATGGAGGG + Exonic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057034797 9:91804206-91804228 AGGCTAGCAGCAGGAATGGCAGG + Intronic
1058334628 9:103810943-103810965 GGACAACCAGCAGTGAAGGCAGG + Intergenic
1058522918 9:105829442-105829464 AGGGAGACAGCACTGATTGCAGG - Intergenic
1058728193 9:107823726-107823748 AGCCAAACTGCAGGGATGGCTGG - Intergenic
1061724856 9:132576645-132576667 AGGCAGGCAGCAGACATGGCTGG - Intergenic
1203613009 Un_KI270749v1:27141-27163 GGGCAAAAAGCCGCGATGGCGGG - Intergenic
1186588597 X:10903753-10903775 AGGGAAACATCAGTGAGGCCAGG + Intergenic
1186877299 X:13828988-13829010 AGTCAGGCAGCAATGATGGCAGG + Intronic
1187724000 X:22183279-22183301 GGGCAGAGAGCAGGGATGGCCGG - Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188599530 X:31944624-31944646 AAACAAACAGGAGTGGTGGCGGG - Intronic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190469731 X:50766295-50766317 AGGGAAAAAGTAGTGGTGGCAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191782962 X:64888180-64888202 AGGCACAGAGCAGTGTTTGCTGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193196586 X:78639430-78639452 TGGCAAAGAGCAGTGAGAGCAGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193504886 X:82330120-82330142 AGCCAACCAGCAGTTATAGCAGG - Intergenic
1193780040 X:85690275-85690297 TGACAAACCACAGTGATGGCTGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic