ID: 997906826

View in Genome Browser
Species Human (GRCh38)
Location 5:137825642-137825664
Sequence ATTTCATTAGGGAAAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997906822_997906826 -8 Left 997906822 5:137825627-137825649 CCAAAGTGAGTCAAAATTTCATT No data
Right 997906826 5:137825642-137825664 ATTTCATTAGGGAAAGCTGGAGG No data
997906820_997906826 18 Left 997906820 5:137825601-137825623 CCTTTAAGATGAGCTGACAGGCA No data
Right 997906826 5:137825642-137825664 ATTTCATTAGGGAAAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997906826 Original CRISPR ATTTCATTAGGGAAAGCTGG AGG Intergenic
No off target data available for this crispr