ID: 997908099

View in Genome Browser
Species Human (GRCh38)
Location 5:137840632-137840654
Sequence TCTGTGGACCAGCAGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997908095_997908099 30 Left 997908095 5:137840579-137840601 CCTTACATTTTAACCAATGCTAA No data
Right 997908099 5:137840632-137840654 TCTGTGGACCAGCAGCATCATGG No data
997908096_997908099 17 Left 997908096 5:137840592-137840614 CCAATGCTAAGACTTTATTCAGC No data
Right 997908099 5:137840632-137840654 TCTGTGGACCAGCAGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997908099 Original CRISPR TCTGTGGACCAGCAGCATCA TGG Intergenic
No off target data available for this crispr