ID: 997908555

View in Genome Browser
Species Human (GRCh38)
Location 5:137845053-137845075
Sequence TTGAAGTTGTTTGTTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997908554_997908555 -10 Left 997908554 5:137845040-137845062 CCAAAAGCTGGATTTGAAGTTGT No data
Right 997908555 5:137845053-137845075 TTGAAGTTGTTTGTTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997908555 Original CRISPR TTGAAGTTGTTTGTTGCTTC TGG Intergenic
No off target data available for this crispr