ID: 997910841

View in Genome Browser
Species Human (GRCh38)
Location 5:137871484-137871506
Sequence TCTAATCCTGAATATCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997910835_997910841 -7 Left 997910835 5:137871468-137871490 CCTATCCCTTTTCCCCTCTAATC 0: 1
1: 0
2: 3
3: 48
4: 361
Right 997910841 5:137871484-137871506 TCTAATCCTGAATATCCACTTGG 0: 1
1: 0
2: 0
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997910841 Original CRISPR TCTAATCCTGAATATCCACT TGG Intronic
900677517 1:3897344-3897366 TCTACTCCAGAATTTCCATTTGG - Intronic
901390848 1:8945134-8945156 CCTAATCCTGTGTATTCACTTGG - Intergenic
901967537 1:12880720-12880742 TTTATGCCTGAATCTCCACTGGG - Intronic
901975336 1:12939851-12939873 TTTATGCCTGAATCTCCACTGGG - Intronic
901982936 1:13050984-13051006 TTTATGCCTGAATCTCCACTGGG - Intronic
901999153 1:13177934-13177956 TTTATGCCTGAATCTCCACTGGG + Intergenic
902009839 1:13261914-13261936 TTTATGCCTGAATCTCCACTGGG + Intronic
902017639 1:13321065-13321087 TTTATGCCTGAATCTCCACTGGG + Intronic
903614294 1:24641019-24641041 CCTACTCCTGGATATCTACTGGG - Intronic
904442015 1:30538172-30538194 TCTAATCCAGACCCTCCACTTGG - Intergenic
904616529 1:31753070-31753092 TCTAATCCTGAGGAGGCACTGGG - Intronic
908256256 1:62305926-62305948 GCTAGTCCTGAATCCCCACTGGG - Intronic
908710266 1:67006724-67006746 TCAAATCCTGAATGTACTCTAGG + Intronic
908787118 1:67746202-67746224 TCTAAAGCTGAATACCAACTGGG + Intronic
909638776 1:77848596-77848618 TCTAATTCTGAATCATCACTGGG + Intronic
910127106 1:83854848-83854870 TCTAACCTTGAATATCCAAATGG + Intergenic
910384731 1:86668968-86668990 TATGTTCCTGAATGTCCACTGGG + Intergenic
910552385 1:88490451-88490473 CCTAATCCTGTATTTCCCCTAGG - Intergenic
911502780 1:98709173-98709195 TCTAATCCTGGTTAGGCACTGGG - Intronic
912991463 1:114491397-114491419 CCTAATCCTGCATTTCCTCTAGG - Intronic
913235524 1:116778109-116778131 TCTAACCCTGTATTTCCCCTGGG + Intergenic
913676662 1:121147161-121147183 TCTGAGCCTAAATGTCCACTGGG - Intergenic
914028558 1:143935111-143935133 TCTGAGCCTAAATGTCCACTGGG - Intergenic
915451571 1:156009095-156009117 TCTAACCCAGAATAGACACTGGG + Exonic
917444783 1:175098195-175098217 TCTCATCCTGAGTCTCCGCTGGG - Intronic
918521267 1:185417575-185417597 TCTATTCATGAATATTCCCTGGG - Intergenic
919008631 1:191930496-191930518 TCAAATCCAGAATTTCCCCTTGG - Intergenic
919816852 1:201446633-201446655 CATAATCCTGTATTTCCACTAGG - Intergenic
920464025 1:206166002-206166024 TCTGAGCCTAAATGTCCACTGGG - Intergenic
922610907 1:226926985-226927007 TCTGATCCTGAATGACTACTGGG + Intronic
924693455 1:246375201-246375223 CCTAATCCTGTATATCTACTAGG + Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1066159372 10:32712678-32712700 ACTAATCCTGATCATCCTCTTGG + Intronic
1068122618 10:52798913-52798935 CCTGCTCCTGAATAACCACTGGG - Intergenic
1068272861 10:54752678-54752700 TCAAATCCTAAAGATACACTCGG - Intronic
1068345946 10:55778084-55778106 TCTTATCCTGATTACCCACTTGG + Intergenic
1070975290 10:80601609-80601631 TCCCATACAGAATATCCACTAGG - Intronic
1071884474 10:89934791-89934813 CCTATTCCTGAATAACTACTGGG - Intergenic
1073872677 10:107883521-107883543 AATAATCCTGAATAACCAGTGGG + Intergenic
1081257361 11:40913430-40913452 TCTACTCCTGAATGACTACTGGG + Intronic
1085434736 11:76490330-76490352 TATAAACCTGACTATCCACTAGG + Intronic
1085864179 11:80268810-80268832 TCTGTTCCTTAGTATCCACTTGG - Intergenic
1086495129 11:87396066-87396088 CCTAATCCTGTATTTCCATTAGG + Intergenic
1086767440 11:90715219-90715241 TATGATCCTGAATAGCCAATGGG - Intergenic
1088259437 11:107929666-107929688 TCTCCTCCTAAATATCCGCTGGG + Intronic
1089090208 11:115867577-115867599 CATTATCCTGAATAGCCACTGGG - Intergenic
1095754674 12:45751252-45751274 TCTTATCCCAAATATCCACCTGG - Intronic
1097917211 12:65033711-65033733 TCTGATCCTGAATGACTACTGGG - Intergenic
1099143509 12:79010247-79010269 TCTAATCTTGAACTTCAACTTGG - Intronic
1100937200 12:99682490-99682512 TCTACTCCTGAATAATCATTGGG + Intronic
1101798064 12:107994956-107994978 TTTAATCAAGAATATTCACTGGG - Intergenic
1108837128 13:54564768-54564790 TCTTATCCCACATATCCACTAGG + Intergenic
1108935524 13:55876451-55876473 TCATATCCTGAATTTCCTCTGGG + Intergenic
1109385668 13:61626498-61626520 TCTGCTCCTGAATAACTACTGGG - Intergenic
1109816483 13:67591256-67591278 TCTACTCCTGAATGACTACTGGG + Intergenic
1112835799 13:103512763-103512785 TCAAATCCTTAATATTCACTTGG + Intergenic
1112944353 13:104908521-104908543 TATACTCCTGAATAACCAATGGG - Intergenic
1116603733 14:46962437-46962459 TCAAACCCAGAATATTCACTAGG - Intronic
1117708667 14:58500166-58500188 CCTAATCCTGTATTTCCCCTAGG - Intronic
1117951199 14:61083883-61083905 TCTAAGCCTGGATATCCATCAGG - Intergenic
1117988432 14:61411035-61411057 TCCAAGCCTGGATATCCAGTGGG + Intronic
1122148745 14:99711042-99711064 TATACTCCTGAATGACCACTGGG + Intronic
1122614547 14:103008073-103008095 TCTAATCGTGAGGATCCTCTAGG + Intronic
1126958726 15:53965403-53965425 TCTAATACTGAATATCAATTTGG + Intergenic
1127452295 15:59128802-59128824 CCTGCTCCTGAATATCTACTGGG - Intergenic
1129495302 15:75974616-75974638 TCTAATCCTGAATGACTACTGGG - Intronic
1139240708 16:65389109-65389131 GCTACTGTTGAATATCCACTCGG + Intergenic
1140278625 16:73533593-73533615 TCCAAACTTGAATATCCAATGGG + Intergenic
1140952271 16:79830280-79830302 TCTAATACTGAATGTACAATAGG + Intergenic
1141311977 16:82922876-82922898 TCAAATCCTCAATATCAACAAGG - Intronic
1142523667 17:522593-522615 TCAAATCCTGATTATTCATTAGG + Intronic
1146120105 17:30185465-30185487 TCTAATTCTGAATCATCACTGGG + Exonic
1146808109 17:35881528-35881550 TCTAATCCAGAAGTTCCACATGG - Intergenic
1148222412 17:45872342-45872364 TCTAATGCTGTATTTCCCCTAGG - Intergenic
1148400345 17:47354134-47354156 TCTGCTCCTGAATAATCACTGGG - Intronic
1150301695 17:64052716-64052738 TCTACTCCTGAAGATACAATGGG + Intronic
1152974373 18:199843-199865 TCTAATCCTGTATTTCCCCTAGG + Intronic
1156135771 18:34035348-34035370 TATACTCCTGAACAACCACTGGG + Intronic
1156145810 18:34176151-34176173 TCAAATCCAGGATTTCCACTTGG - Intronic
1156172454 18:34502613-34502635 TCTAATTCTAAATATCCAATGGG - Intronic
1159317030 18:66788747-66788769 TATCATCCTGAATATGCACTTGG - Intergenic
1162960811 19:14125340-14125362 TCTAACCCTGTATTTCCCCTGGG + Intronic
1164476172 19:28577608-28577630 TCTAGACCTGGATATCCCCTGGG - Intergenic
925557486 2:5147569-5147591 TCTGTTCCTGAATATGCTCTCGG - Intergenic
926099252 2:10103554-10103576 TCTAAACATGCATACCCACTAGG + Intergenic
930247206 2:48996380-48996402 TCTAACCCTGAATTTCCCATGGG - Intronic
931018120 2:58009941-58009963 TCCAATACTTAATGTCCACTAGG + Intronic
933507462 2:83196787-83196809 TATATTCCTGAATATCTCCTTGG - Intergenic
934603474 2:95676795-95676817 TCTAAGGCTGAACTTCCACTTGG + Intergenic
935215999 2:100975792-100975814 TTTAATCCTTAAAATTCACTTGG - Intronic
936536863 2:113319021-113319043 TCTAAGGCTGAACTTCCACTTGG + Intergenic
939414327 2:141873895-141873917 TCTAGTCGTGAAAATTCACTAGG - Intronic
944900758 2:204213331-204213353 CCTAATCCTGTATTTCCCCTAGG + Intergenic
947100251 2:226613047-226613069 CTTGCTCCTGAATATCCACTGGG - Intergenic
947186547 2:227460390-227460412 TCCAATCCTGGATCTCCCCTGGG + Intergenic
1169734038 20:8817588-8817610 TCTCATCCTGGAAATCCTCTGGG + Intronic
1170721882 20:18888591-18888613 TCTAATCCTGCAGTTCCCCTAGG + Intergenic
1173061858 20:39670129-39670151 TCTCATCCTGAGTTGCCACTGGG - Intergenic
1174885330 20:54327946-54327968 TCTATTCCACAACATCCACTGGG + Intergenic
1177934990 21:27334161-27334183 TCTGCTCCTGAATAATCACTGGG + Intergenic
1180579513 22:16818437-16818459 TCCAATTCTGAATCTCCAATAGG + Intronic
1181539394 22:23565435-23565457 TCCAATCCTGAGGCTCCACTAGG - Intergenic
951143115 3:19191897-19191919 CCTAATCATGAATATCCAAAAGG - Intronic
951182889 3:19679934-19679956 CCTGCTCCTGAATGTCCACTGGG - Intergenic
951259642 3:20492290-20492312 TATACTCCTGAATAACCACTGGG - Intergenic
954969991 3:54643527-54643549 TTTATTCCTGGATATCCTCTGGG - Intronic
956760474 3:72438996-72439018 TCCAATCCTGAGTATCAACAAGG - Intronic
956905097 3:73757532-73757554 TCTAATCCTGAATACCCCCCGGG - Intergenic
958070351 3:88602690-88602712 CCTACTCCTGAATAATCACTGGG + Intergenic
958097349 3:88963756-88963778 TCTGATCAGGAATATCCAGTGGG - Intergenic
959116718 3:102187107-102187129 CCTAACCCTGAATTTCCCCTAGG - Intronic
959788970 3:110333803-110333825 TCTTATCTTGAATTTCCACTTGG - Intergenic
961596632 3:128022829-128022851 TCAACTCCAGAATTTCCACTTGG + Intergenic
963309565 3:143694366-143694388 TCTGAACCTGAATATCCATGAGG + Intronic
963332614 3:143932061-143932083 TTTAATCCTGAATGACTACTGGG + Intergenic
965657689 3:171006374-171006396 TCTCATCCTGACTGTCCAATTGG - Intronic
965979268 3:174667398-174667420 TCTTATCATGAATATACACAGGG + Intronic
967851439 3:194085569-194085591 TCTAATCCTGACTGCCCCCTAGG - Intergenic
969401935 4:6961534-6961556 TTTAATCCTGAGTCTCCTCTCGG + Intronic
972927302 4:44026186-44026208 TCTGATGCTCAATATCCAGTAGG - Intergenic
974370840 4:61014513-61014535 CCTGCTCCTGAATAACCACTGGG + Intergenic
974994727 4:69140620-69140642 TCTAATTCTGGCTACCCACTCGG + Intronic
975843762 4:78503973-78503995 TCTGCTCCTGAATAACTACTGGG - Intronic
978496323 4:109363444-109363466 TCTAACCCTGTATTTCCCCTAGG + Intergenic
978822565 4:112982409-112982431 GCCAATTCTGAACATCCACTCGG + Intronic
979508910 4:121529285-121529307 TCTTATCCCAAATATCTACTTGG + Intergenic
979985231 4:127305808-127305830 TTTAATATTGAGTATCCACTAGG + Intergenic
980342460 4:131568155-131568177 TTTCATCCTGATTATCCTCTAGG - Intergenic
982327027 4:154138327-154138349 TCTAATCTTTAATCTACACTTGG + Intergenic
984010468 4:174365178-174365200 TTTAATTCTGAACAACCACTGGG + Intergenic
987595406 5:19990969-19990991 TCTGATACTGAATTCCCACTTGG + Intronic
989177049 5:38538449-38538471 TCTGATGCTTCATATCCACTTGG + Intronic
989310087 5:40005886-40005908 CATACTCCTGAATATCCAATGGG - Intergenic
991206657 5:64057790-64057812 TTTAATCCTAAATGTCCAGTAGG + Intergenic
993268958 5:85768336-85768358 TATACTCCTGAATATACAGTGGG - Intergenic
994850758 5:105052488-105052510 TCTGCTCCTGAATAACTACTGGG - Intergenic
995178304 5:109204855-109204877 TGTAATCTTGTATTTCCACTGGG - Intergenic
995790846 5:115884603-115884625 TGTAAACGTGAATATCCAATTGG - Intronic
996024856 5:118633306-118633328 CCTAATCCTGTATTTCCTCTAGG - Intergenic
997788519 5:136736009-136736031 TCTAATACTGGCTACCCACTCGG + Intergenic
997910841 5:137871484-137871506 TCTAATCCTGAATATCCACTTGG + Intronic
998780740 5:145653632-145653654 TCTGCTCCTGAATGACCACTGGG + Intronic
998803440 5:145894016-145894038 TCTGCTCCTGAATGACCACTGGG + Intergenic
1001364850 5:171126204-171126226 TATGCTCCTGAATAACCACTGGG + Intronic
1002139375 5:177129642-177129664 GCTATTCCTGAATATCCTCCAGG + Intergenic
1003213499 6:4088742-4088764 TCAAAACCTGACTTTCCACTTGG - Intronic
1003327462 6:5103309-5103331 CGTAATAATGAATATCCACTCGG + Intronic
1003375661 6:5574671-5574693 CCTAATCCTGCATTTCCTCTAGG - Intronic
1008770882 6:54978611-54978633 CCTAATCCTGTATTTCCCCTTGG - Intergenic
1009000131 6:57703282-57703304 TCTGCTCCTGAATAACTACTGGG + Intergenic
1009266250 6:61558673-61558695 TATACTCCTGAATAACCAGTTGG - Intergenic
1010143934 6:72644168-72644190 CCTAACCCTGTATTTCCACTAGG - Intronic
1010862830 6:80935017-80935039 TCTGCTCCTGAATAATCACTGGG - Intergenic
1013998688 6:116340406-116340428 TCAAATCCAGAATATGCATTTGG + Intronic
1018831522 6:167447387-167447409 TGTATTCCTGGATATCCACAAGG - Intergenic
1021484823 7:21156431-21156453 TCCATTCTTGAATTTCCACTTGG - Intergenic
1022216682 7:28269991-28270013 TCTAATCCTAAAAATCCTGTTGG - Intergenic
1025714743 7:63944473-63944495 TCTATTCCTGAATGACTACTGGG + Intergenic
1029047906 7:97650559-97650581 CCTAATCCTGTATTTCCCCTAGG + Intergenic
1029837898 7:103332498-103332520 TCTAATGCTGAATATAAACTTGG - Intronic
1030390616 7:108922998-108923020 TATACTCCTGAATGACCACTGGG - Intergenic
1030885085 7:114926931-114926953 TCTAATCCTGGTTCTCTACTGGG + Intronic
1031865003 7:127029094-127029116 TCTGCTCCTGAATAACTACTGGG - Intronic
1034824059 7:154244891-154244913 TCTAAAACTGATTATTCACTGGG - Intronic
1037000449 8:13711422-13711444 TATGCTCCTGAACATCCACTGGG - Intergenic
1040669457 8:49671778-49671800 CTTAAGCCTGTATATCCACTTGG - Intergenic
1043088934 8:75873635-75873657 TCTGCTCCTGAATAACTACTGGG - Intergenic
1046427998 8:114080982-114081004 CCTAATCCTGTATCTCCTCTAGG - Intergenic
1046521566 8:115332348-115332370 TCCAATCCAAAATATGCACTGGG + Intergenic
1046711044 8:117512021-117512043 TGGAATCCTGAACATCCCCTGGG - Intergenic
1049754403 8:144303116-144303138 TCTACTCCAGAGTTTCCACTGGG + Intronic
1051857358 9:21584161-21584183 TCAAATCCTGACTCTGCACTTGG + Intergenic
1051945872 9:22569244-22569266 TCTACTCCTGAATGACTACTGGG - Intergenic
1052154584 9:25168977-25168999 TCTGTTCCTGAATAACAACTGGG + Intergenic
1052620633 9:30904704-30904726 TCTAATCCTGTATTTTCCCTGGG + Intergenic
1055263172 9:74463535-74463557 TCTAATTCTGGACATCCACTGGG - Intergenic
1055617343 9:78086482-78086504 TCTGCTCCTGAATAACTACTGGG + Intergenic
1055983209 9:82027140-82027162 CCTAATCCTGTATTTCCCCTAGG + Intergenic
1056618488 9:88189456-88189478 TTTAATTCTGAATAATCACTGGG - Intergenic
1057642268 9:96835898-96835920 CCTAATCCTGAAGCTCCACTAGG - Intronic
1057854554 9:98592721-98592743 TCTAATCCTGAGAATCCATAAGG + Intronic
1061275536 9:129567941-129567963 TCCAATCCTGAGGCTCCACTAGG - Intergenic
1185998177 X:4977227-4977249 TCTCACCCTGACTCTCCACTGGG + Intergenic
1186501465 X:10054279-10054301 ACTAATCCTGAAAAGCCATTTGG - Intronic
1189559808 X:42180674-42180696 CCTAATCCTGTATTTCCCCTAGG + Intergenic
1192486131 X:71528357-71528379 TCTAATCCTGACTGTCCTCCTGG - Intronic
1194479103 X:94398127-94398149 TATGATCCTGAATAACCAGTGGG - Intergenic
1195366251 X:104128888-104128910 TCTAAACCTGTATTTCCACTAGG - Intronic
1195681739 X:107552392-107552414 TATAAGTCAGAATATCCACTTGG - Intronic
1197646305 X:129021364-129021386 TCTTATCTGGAATCTCCACTGGG - Intergenic
1198015138 X:132602768-132602790 TCTAATCCTGAAAAGCCAGCTGG - Intergenic
1199189790 X:144956723-144956745 TATAATCCTGAATGACCAGTGGG + Intergenic
1201543538 Y:15135180-15135202 CCTGATCCTGAATAACTACTGGG + Intergenic
1201600684 Y:15725576-15725598 TCTGCTCCTGAATAACTACTGGG - Intergenic
1201856983 Y:18555490-18555512 TCCAATCCAGAATCTCCAATAGG - Intronic
1201876338 Y:18764890-18764912 TCCAATCCAGAATCTCCAATAGG + Intronic
1202341944 Y:23878908-23878930 CCTGCTCCTGAATGTCCACTGGG - Intergenic
1202528824 Y:25791177-25791199 CCTGCTCCTGAATGTCCACTGGG + Intergenic
1202602174 Y:26604648-26604670 TCTGCTCCTGAATAACTACTTGG + Intergenic