ID: 997915139

View in Genome Browser
Species Human (GRCh38)
Location 5:137917116-137917138
Sequence TCTACTTGATGGTGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997915135_997915139 8 Left 997915135 5:137917085-137917107 CCTTTTGGAACTTCCATAATGTG 0: 1
1: 2
2: 12
3: 60
4: 277
Right 997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG No data
997915133_997915139 26 Left 997915133 5:137917067-137917089 CCTTTCTCTTTCTCTTATCCTTT 0: 1
1: 5
2: 60
3: 597
4: 4074
Right 997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG No data
997915137_997915139 -5 Left 997915137 5:137917098-137917120 CCATAATGTGTATGTTGGTCTAC 0: 1
1: 1
2: 18
3: 59
4: 636
Right 997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997915139 Original CRISPR TCTACTTGATGGTGTCCTGC AGG Intronic
No off target data available for this crispr