ID: 997916572

View in Genome Browser
Species Human (GRCh38)
Location 5:137932662-137932684
Sequence CTTTATCAGCAGCAGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997916572_997916574 6 Left 997916572 5:137932662-137932684 CCTCACTGCTGCTGCTGATAAAG 0: 1
1: 0
2: 2
3: 40
4: 383
Right 997916574 5:137932691-137932713 TATTCTTTATCCAAAATGCTTGG No data
997916572_997916575 7 Left 997916572 5:137932662-137932684 CCTCACTGCTGCTGCTGATAAAG 0: 1
1: 0
2: 2
3: 40
4: 383
Right 997916575 5:137932692-137932714 ATTCTTTATCCAAAATGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997916572 Original CRISPR CTTTATCAGCAGCAGCAGTG AGG (reversed) Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
902115476 1:14117513-14117535 CTTTATCAGCAGCATGAAAGTGG + Intergenic
902165527 1:14568352-14568374 CTTTATCAGCAGCATGAAAGCGG - Intergenic
903302043 1:22386129-22386151 CATCATCAGCAGCAGGGGTGTGG - Intergenic
905289282 1:36910550-36910572 CTCTCTCAGCAGCAGTGGTGGGG + Intronic
905560873 1:38926330-38926352 GTTCAGCAGCAGCAGCACTGAGG + Exonic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907643214 1:56213680-56213702 CTCTATGAGATGCAGCAGTGTGG - Intergenic
909177473 1:72379649-72379671 CTTTATTAGCAGCATCAGAATGG - Intergenic
909864418 1:80649179-80649201 CTTTATCAGCAGCATGAATACGG + Intergenic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
910642820 1:89481789-89481811 CTTTATCAGCAGCAGGACAATGG - Intergenic
911174390 1:94804591-94804613 CTTTATCACCACTAGCAGCGTGG - Intergenic
911307983 1:96254766-96254788 CTTTATCAGCAGCATGAAAGTGG + Intergenic
912056007 1:105598430-105598452 CTTTATTAGCAGCATAAGAGTGG + Intergenic
912140665 1:106721997-106722019 GTTTCACAGCAGCAGTAGTGTGG + Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
913478641 1:119263317-119263339 CTTTTTAAGCAGTAGCAGTATGG + Intergenic
914420970 1:147528107-147528129 TTTCATCTGCAGCAGTAGTGAGG + Intergenic
915451304 1:156007242-156007264 CTTTTGCTGCTGCAGCAGTGGGG - Intergenic
916405878 1:164497442-164497464 GCTTCTCAGCACCAGCAGTGAGG - Intergenic
916799867 1:168206751-168206773 CTTTCTCAGTATCAGCAGTAAGG + Intergenic
916904277 1:169264831-169264853 CTTTATTAGCAGCATGAGTACGG - Intronic
917088037 1:171323324-171323346 CTTGAGCAGCAGCGGAAGTGAGG - Intronic
917895164 1:179480180-179480202 CTTTATCAGCAGCATGAGAATGG - Intronic
919054979 1:192559320-192559342 CTTTCTCCACATCAGCAGTGAGG + Intergenic
919163606 1:193863661-193863683 CTTTATCAGCAGCATGAAAGCGG + Intergenic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
921695446 1:218203910-218203932 CTTTATTAGCAGCATGAGTACGG + Intergenic
922485498 1:225970177-225970199 CTCCATCTGCAGCACCAGTGCGG + Intergenic
922897303 1:229110314-229110336 CTATAACTGCAGAAGCAGTGAGG - Intergenic
923098076 1:230791393-230791415 CATTTTCACCAGCAGCAGTATGG + Intronic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
923762318 1:236858122-236858144 CTTTATCAGCAGCATGAGAATGG - Intronic
923876691 1:238057696-238057718 CTTTATCAGCAGCATGAGAATGG - Intergenic
924071986 1:240289976-240289998 CTTTGTCAGCACCAGAAATGTGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1063841526 10:10077065-10077087 CTTTATCAGCAGCATGAGAACGG + Intergenic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065897569 10:30177747-30177769 CTCATTCAGCAGCAGCAGTGGGG + Intergenic
1068747640 10:60553068-60553090 CTTTATCAGCAGCATGAGAATGG + Intronic
1070407587 10:76110824-76110846 CTTTATCAGCAGCATCAAAATGG + Intronic
1070430103 10:76329028-76329050 CTCTATCTGAAGCACCAGTGAGG + Intronic
1070457706 10:76633546-76633568 CTGTATCTGCAGCATCTGTGAGG - Intergenic
1070941440 10:80351662-80351684 TTGTATCAGCAACAACAGTGTGG + Intronic
1070941863 10:80355725-80355747 TTGTATTAGCAACAGCAGTGGGG + Intronic
1071715089 10:88087627-88087649 ATTTTTCAGGACCAGCAGTGTGG + Intergenic
1072601208 10:96931755-96931777 TTGTTTCAGCAGCAGCAGTTAGG + Intronic
1074310838 10:112322013-112322035 CTTTATCAGCATCACCTGGGAGG + Intergenic
1074500661 10:114020978-114021000 CTTTATCAGCAGCATGAGAACGG + Intergenic
1075200254 10:120396384-120396406 CTTCACCAGCAGCAGCAGCATGG - Intergenic
1075327895 10:121549376-121549398 ATTCCTCAGTAGCAGCAGTGGGG - Intronic
1075536758 10:123278027-123278049 CTTTATCAGCAGCATGAGAATGG - Intergenic
1078436999 11:11333676-11333698 CTTTCTCAGGAGCATCAGAGAGG + Intronic
1078517798 11:12039612-12039634 CTTTATCAGCAGCATGAGAATGG - Intergenic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1079018952 11:16893514-16893536 CTTTCTCAGCCCCAACAGTGTGG - Intronic
1079600231 11:22303010-22303032 CTTTATCAGAATTAACAGTGAGG - Intergenic
1080825720 11:35847332-35847354 TTTGACCAGCAGCAGCAGTGGGG + Intergenic
1080975827 11:37339329-37339351 ATTTTTCAGCAGCGTCAGTGAGG + Intergenic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1081507360 11:43732328-43732350 CTTTATCAGCAGCGTGAGAGTGG + Intronic
1081702659 11:45161789-45161811 CTTAGGCAGCAGCATCAGTGTGG - Intronic
1081735019 11:45396644-45396666 CTTTATCCAGAGCAGCAATGTGG - Intergenic
1084041920 11:66547342-66547364 TGTTTTCAGCAGCAGAAGTGGGG - Intronic
1084627990 11:70323535-70323557 CATTATCAGCTGCAGCAGTCTGG + Intronic
1085312494 11:75524979-75525001 CTATTTCAGGAGTAGCAGTGAGG + Intronic
1085866660 11:80302915-80302937 CTTTATCAGCAGCATGAGAATGG + Intergenic
1086155905 11:83665849-83665871 CTCTATCAGCTGTAGCAGTTAGG + Intronic
1086778350 11:90869114-90869136 CTTTCTCCATAGCAGCAGTGAGG - Intergenic
1089912580 11:122116938-122116960 CTTACTTAGCAGCAGCAGAGAGG + Intergenic
1090638533 11:128709624-128709646 CTTTATCAGCAGCACAAGCCTGG - Intronic
1090647751 11:128779271-128779293 CTTTATTTGCTCCAGCAGTGAGG + Intronic
1091153194 11:133348530-133348552 TTCTCTCAGCAGCATCAGTGAGG - Intronic
1092132847 12:6124591-6124613 CTTTATCTCCCCCAGCAGTGGGG - Exonic
1093195474 12:16125159-16125181 TATCATCAGCAGGAGCAGTGTGG + Intergenic
1093207219 12:16264920-16264942 CTTTATCAGCAGCATGAAAGTGG + Intronic
1093211363 12:16313037-16313059 CTTTATCAGCAGCAGTAAAATGG + Intergenic
1093406754 12:18813727-18813749 GGCTAGCAGCAGCAGCAGTGGGG + Intergenic
1093784212 12:23174086-23174108 CTTTATTAGCAGCATCAGAATGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095516786 12:43015200-43015222 CTTTATCACCATCAGCATTTTGG - Intergenic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1100979252 12:100151975-100151997 CTTTATAATCAGTAGAAGTGTGG - Intergenic
1101163971 12:102009098-102009120 CTCTGTCAGAGGCAGCAGTGTGG - Intronic
1101264416 12:103068145-103068167 CATGATCAGCTGCAGAAGTGGGG + Intergenic
1102540602 12:113616507-113616529 CTTTATCACCAGCAGCCTTCTGG - Intergenic
1102826206 12:115949752-115949774 CTTTATCAGCACCAAGACTGGGG + Intergenic
1104034048 12:125086387-125086409 CTTTGTTTGCAGCAGCAATGAGG + Exonic
1104528832 12:129549648-129549670 CTTTATCAGCAGCATGAGAATGG + Intronic
1104879472 12:132060517-132060539 ACTTGTCAGCAGCAGCAGTGAGG + Intronic
1105756339 13:23467418-23467440 CTTAATTAGTAGCAGCTGTGCGG + Intergenic
1106769690 13:32949977-32949999 CTTTTTCCCCAGCAGCAGTGAGG + Intergenic
1107991686 13:45824372-45824394 CTTTATCGACAGCAGCAAGGGGG - Intronic
1108011720 13:46021211-46021233 GTTTTTTAGCAGCAGTAGTGAGG - Intronic
1108196157 13:47997559-47997581 CACTCCCAGCAGCAGCAGTGGGG - Intronic
1108745514 13:53389417-53389439 CTTTATCAGCAGCATGAGAATGG - Intergenic
1108871679 13:54994536-54994558 CTTTATCAGCAAAAGGATTGTGG + Intergenic
1109089696 13:58025635-58025657 CATTATCTGAAGCAACAGTGAGG - Intergenic
1109221607 13:59646059-59646081 CTTTATCAGCAGCATGAATATGG + Intergenic
1109375707 13:61489435-61489457 TATTATCAGCAGCAGAAGTTTGG - Intergenic
1109448131 13:62471953-62471975 CTTTATCAGCAGCATGAGAATGG - Intergenic
1110401554 13:75097359-75097381 CTTTGACAGCAGCATCACTGAGG - Intergenic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1111074398 13:83214690-83214712 CTTTATCAGCAGCATGAGAATGG - Intergenic
1111527456 13:89491427-89491449 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1112359764 13:98706780-98706802 CTTTATCAGCAGCATGAGAATGG + Intronic
1113707681 13:112445095-112445117 CCTTTTCAGCAGCAACAGGGAGG - Intergenic
1113868573 13:113544537-113544559 CTTTATCAGCAGCCGCTGTTGGG + Intronic
1114797987 14:25738992-25739014 CTTTATCAGCAGCAAAAATGTGG - Intergenic
1115257327 14:31417114-31417136 GTTTATCATAAGCAGCAGTAAGG - Intronic
1115822170 14:37224349-37224371 CTTTATCAGCAGCATGAAAGTGG - Intronic
1116045934 14:39742227-39742249 CTTTATCAGCAGCATTAGAATGG + Intergenic
1116937292 14:50754311-50754333 CTTTATCATCAGCAGAATTGAGG - Intronic
1117129469 14:52670575-52670597 TTTTAACAGCAGCAGCACTCTGG + Intronic
1117639134 14:57778287-57778309 CTTTATCAGCAGCATGAGAATGG + Intronic
1118228743 14:63928008-63928030 CTTTATCAGCAGCATGAGAATGG + Intronic
1119142856 14:72283682-72283704 CTTTATCAGCAGCATGAGAATGG + Intronic
1119216177 14:72870922-72870944 CTTTATCAGCAGCATGAAAGTGG - Intronic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1121442249 14:93956587-93956609 CCATCTCAGCAGGAGCAGTGGGG + Intronic
1121466977 14:94122127-94122149 CTTTAATAGCAGCAGGAGTGGGG - Intergenic
1121873054 14:97426888-97426910 CTTTAGAAGCAGCAGCACTTAGG + Intergenic
1121964932 14:98295321-98295343 CTTTCCCAGCAGCAGCAGCTGGG - Intergenic
1122087520 14:99317957-99317979 CTTTATCAGCAGGGCTAGTGAGG - Intergenic
1123183352 14:106490338-106490360 CTTTATCATCTGCACCAATGAGG - Intergenic
1202946632 14_KI270726v1_random:33545-33567 CTTTATCAGCTGCAGGAGGCGGG + Intergenic
1126268756 15:46787488-46787510 ATTTGTCAACAGCACCAGTGTGG + Intergenic
1128535688 15:68488554-68488576 CTTTATCAGCAGCATGAGAACGG - Intergenic
1128668650 15:69557916-69557938 CATGTTCAGAAGCAGCAGTGTGG + Intergenic
1128855213 15:71005185-71005207 TTTTATCAGGAGCAGAAGTTGGG - Intronic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1131123434 15:89837791-89837813 CTTTTCCTGCAGCAGCAGAGTGG + Intronic
1132282867 15:100635200-100635222 CTTAATAAGCAGCAGCTCTGAGG - Intronic
1133378895 16:5313513-5313535 CTTTATCAGCAGCATGAATATGG - Intergenic
1133692371 16:8229206-8229228 CTTTGTCAGTAGCAGCACAGGGG + Intergenic
1134376520 16:13680454-13680476 CTTTATCTGCTGCAGCTGAGAGG + Intergenic
1135976814 16:27113817-27113839 CTTTGGGACCAGCAGCAGTGGGG - Intergenic
1135988565 16:27202826-27202848 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1137855789 16:51793299-51793321 CTTTATAAAAAGCAACAGTGTGG + Intergenic
1138073994 16:54022471-54022493 CTTTATTTGAAACAGCAGTGAGG + Intronic
1138220677 16:55247799-55247821 CTTTATCAGCAGCATGAGAATGG - Intergenic
1138400953 16:56743581-56743603 TTTGATTGGCAGCAGCAGTGGGG + Intronic
1139085968 16:63586375-63586397 GTTCATCAGCAGCAACAGTGTGG - Intergenic
1139821107 16:69722065-69722087 CATTATCAGGAGCAACTGTGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141531821 16:84651526-84651548 CTTTACCAACAGCAGCTGTGGGG - Intronic
1141623116 16:85247638-85247660 GTTTAGCAGCAGCAGCGTTGGGG + Intergenic
1144018494 17:11219983-11220005 CATTATCAGGAGCAGCTCTGCGG + Intergenic
1144256807 17:13476410-13476432 CTTTCTCAACTGCAGCACTGTGG + Intergenic
1144307859 17:13985383-13985405 CTTTATAATCAGCAACAGTAAGG + Intergenic
1144701998 17:17346291-17346313 CATCACCAGCAGCACCAGTGTGG + Intronic
1146316436 17:31810833-31810855 CTTTATTAGAAGATGCAGTGTGG + Intergenic
1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG + Intergenic
1148484473 17:47981930-47981952 CTTTATCACCAGAAGCAAAGGGG - Intergenic
1148803973 17:50254541-50254563 CTTTGTCACCAGCTGGAGTGTGG - Intergenic
1151216788 17:72582598-72582620 CTTTATCAGCAGCATAAGAATGG + Intergenic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1154312984 18:13281881-13281903 CTTTATCAGCAGCATGAATCCGG - Intronic
1155176471 18:23305712-23305734 CTTTCTCAGGAGCGCCAGTGGGG - Intronic
1156728070 18:40154445-40154467 CTTTATGACCAGTAGCATTGAGG + Intergenic
1156995339 18:43459134-43459156 CTTTTTCAACAGGATCAGTGAGG + Intergenic
1157007815 18:43606921-43606943 TTCTAGCAGCAGCTGCAGTGTGG + Intergenic
1157814668 18:50722032-50722054 CTTTGTCAGCAGCACCTGGGAGG + Exonic
1158527318 18:58226755-58226777 CTCTGTCAGCTGTAGCAGTGAGG - Intronic
1159772644 18:72564952-72564974 ATTTCTCAGCAGGAGCAGTTAGG + Intronic
1160292078 18:77604036-77604058 CTTTATCAGCAGCCTGAGAGTGG - Intergenic
1161694603 19:5759095-5759117 CTAAAACAGCAGCAGCACTGGGG + Exonic
1161937545 19:7381374-7381396 CTTTATCCGAAACAGCAGTGGGG + Intronic
1163263557 19:16205391-16205413 CTTTATAAGCAGGGGCAGTGGGG - Intronic
1163283039 19:16328676-16328698 CTTCATCAGCAGCGGAAGTGAGG - Intergenic
1163518942 19:17780663-17780685 CTTTCTCAGCCTCAGCACTGTGG - Intronic
1163740787 19:19010568-19010590 TTCCATCAGCAGCAGCCGTGAGG + Intronic
1164394622 19:27851851-27851873 CTTTCACAGGAGCTGCAGTGGGG + Intergenic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
1165068293 19:33241370-33241392 CTTTCACAGCAGCAACCGTGAGG + Intergenic
1167006062 19:46777378-46777400 CTTCATCATCAGCGGCAGCGTGG + Exonic
1167539468 19:50075846-50075868 CGTTGATAGCAGCAGCAGTGGGG - Intergenic
1167630243 19:50622011-50622033 CGTTGATAGCAGCAGCAGTGGGG + Exonic
1168083155 19:54025129-54025151 CTCTATCAGCCGAAGCAGTCAGG + Intergenic
1168714044 19:58516920-58516942 CGCTGTCAGCAGCAGCAGTGAGG + Exonic
925151975 2:1621103-1621125 CTTTATCAGCAGCATGAAAGTGG + Intergenic
925337241 2:3107438-3107460 CTTTATTAGCAGTGGCACTGAGG + Intergenic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
927605472 2:24482779-24482801 GTTTCTCAGCACCAGCAGCGGGG + Intergenic
927641304 2:24847372-24847394 CTTTATCAGCAGCATGAATGTGG + Intronic
927971373 2:27307842-27307864 CTGTACCAGGAGCAGCAGCGCGG + Exonic
928327547 2:30331842-30331864 CTTTATCAGCAGCATGAGAATGG + Intergenic
928549609 2:32357658-32357680 CTTTTTCAGCGGCTGCAGTTGGG + Intronic
930254845 2:49078092-49078114 CTTTATCAGCAGCATGAAAGTGG - Intronic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
935029049 2:99304459-99304481 CTTTATCAGCAGCATGAAAGTGG + Intronic
935220494 2:101008160-101008182 CCCGATCTGCAGCAGCAGTGTGG + Exonic
935243363 2:101197003-101197025 CTTTCTCAGCAGAAACACTGTGG - Intronic
935625763 2:105171197-105171219 CTTTATCAGCAGCATCAAAACGG - Intergenic
936035370 2:109106891-109106913 AGTTATAAGCAGGAGCAGTGTGG - Intergenic
936147163 2:109987641-109987663 CGCTGTCAGCAGCAGCAGTGAGG + Intergenic
936197529 2:110383842-110383864 CGCTGTCAGCAGCAGCAGTGAGG - Intergenic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
938190993 2:129280596-129280618 CTTCAACAACAGCAGCAGGGAGG - Intergenic
938319161 2:130351549-130351571 CCTGGTCAGCAGCAGCAGTGAGG + Intergenic
938566846 2:132526317-132526339 CTGTAGAAGCTGCAGCAGTGAGG + Intronic
939005071 2:136777449-136777471 CTATTTCAGCAGGACCAGTGAGG - Intronic
939101433 2:137898894-137898916 CTTAATTAGCACCAGCAGCGTGG + Intergenic
939226947 2:139376764-139376786 CTTTATTAGCAGCAAGAGTCCGG - Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939423268 2:142001203-142001225 CTTTATCAGCAGCATGAGAATGG + Intronic
941513169 2:166438408-166438430 CTTTATTAGCAGCATGAGAGTGG + Intronic
941998323 2:171622547-171622569 CATCATCAGCAGCAGCACTTTGG + Intergenic
942087323 2:172455519-172455541 ATTTAGCAGCAGCTGCAGTCAGG - Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
943123992 2:183773335-183773357 CTTTATCAGCAGCATGAGAACGG + Intergenic
943786784 2:191886163-191886185 CTTCATCACCAACAGCAGAGGGG - Intergenic
945457249 2:210064262-210064284 CTTTATCAGCAGCATGAATATGG + Intronic
946974540 2:225133807-225133829 CTTTATCAGCAGCATGAGAATGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947976303 2:234369062-234369084 TTTTATGAGCTGCAACAGTGAGG + Intergenic
948350504 2:237336216-237336238 GTTTTGCAGCAGCAGCAGCGGGG + Exonic
1169284783 20:4298838-4298860 CTTTGTCAGCAGCAGCCTTCTGG + Intergenic
1170773572 20:19355841-19355863 CTTTATCATCAACGGCAGTCAGG - Intronic
1172379938 20:34481524-34481546 CTTTATCAGCAGCAGGAAAGTGG - Intronic
1172730394 20:37082211-37082233 CTGTATCATCACCAGCAGGGGGG - Intronic
1173955691 20:47030907-47030929 CTTTATAAGCAGCAGCAGCCTGG - Intronic
1174365735 20:50055167-50055189 CTTTATCAAAAGCGGCTGTGAGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176032458 20:63019624-63019646 ATTTATCACCAGCAGACGTGCGG - Intergenic
1178745956 21:35250562-35250584 CTTTATCAGCAGCATGAGAATGG + Intronic
1179678360 21:43000275-43000297 CTTTATCAGCAGCATGAATATGG - Intronic
1180573825 22:16753674-16753696 CTTTATCAGCAGTATGAATGTGG + Intergenic
1180699466 22:17773796-17773818 GTTTCCCAGCAGCAGCAGCGAGG + Exonic
1181159932 22:20953836-20953858 CTTGGTCAGCAGCAGCACTAAGG - Intergenic
1181405154 22:22679174-22679196 CTGAATCAGCAGCAACATTGGGG + Intergenic
1181408310 22:22700818-22700840 CTGAATCAGCAGCAACATTGAGG + Intergenic
1181493354 22:23274490-23274512 TTTTGTCAGAAGCAGCACTGAGG + Intronic
1181959065 22:26610079-26610101 CTTCTTCAGCAGGACCAGTGAGG + Intronic
1182577469 22:31282810-31282832 CCTTAGCAGCAGCATCACTGTGG + Exonic
1183061303 22:35337920-35337942 CTTTCCCAGCTGCCGCAGTGGGG - Intronic
1183632397 22:39041152-39041174 CCTATTCAGAAGCAGCAGTGGGG - Intronic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
1184305086 22:43592747-43592769 GTTTTTCAGCAGCACCAGAGTGG - Intronic
950251603 3:11470179-11470201 CTTCATCTTCAGCAGGAGTGTGG + Intronic
951454025 3:22870650-22870672 ATTTATCAGAACCAGCTGTGTGG - Intergenic
955604758 3:60689288-60689310 CTTTATCAGCAGCAGTAAAAAGG + Intronic
956596865 3:70976725-70976747 TTATACCAGCATCAGCAGTGTGG - Intronic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
958076836 3:88691130-88691152 CTTTATCAGCAGCATGAGAACGG - Intergenic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
958794171 3:98689676-98689698 CTTTATAAACAGGAGAAGTGTGG + Intergenic
959173045 3:102867342-102867364 CATTATCAGCAGGAACAATGTGG + Intergenic
959914307 3:111798879-111798901 CTTTATTAGCAGCATGAGAGTGG - Intronic
959947862 3:112146042-112146064 CTTTATCAGCAGCAGAAAAACGG + Intronic
960583281 3:119298277-119298299 TATTTTCAGCAGCAGCAGTAAGG - Intronic
960916588 3:122701523-122701545 GTTTACCACCAGCAGCAGCGGGG + Exonic
965629325 3:170715387-170715409 CTTTATCAGCAGCATAAGAATGG - Intronic
969109959 4:4838423-4838445 CTCATCCAGCAGCAGCAGTGGGG - Intergenic
969161358 4:5261838-5261860 TTTTATTAGCAGAAGCACTGAGG + Intronic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969689369 4:8695856-8695878 CTTAATCAGCTGCAGCCCTGGGG + Intergenic
969852304 4:9969570-9969592 CTTTATCAGCAGCATCAAAAGGG - Intronic
970560708 4:17279571-17279593 CTTTATCAGCAGCATGAGAATGG - Intergenic
971484690 4:27147293-27147315 CTTTATCAGCAGCATGAGAATGG - Intergenic
971742089 4:30534086-30534108 CTTTATCAGCAGCATGAAAGTGG + Intergenic
972936181 4:44138627-44138649 CTTTGTGAGAACCAGCAGTGGGG - Intergenic
973604930 4:52577121-52577143 CTTTATGAGATGAAGCAGTGTGG - Intergenic
973696332 4:53494382-53494404 CTTTATCAGCAGCAAGAGAATGG + Intronic
974445593 4:61976838-61976860 CTTTATCAGCAGCATGAGAATGG + Intronic
974742093 4:66020809-66020831 CTTTATTAGCAGCATTAGAGTGG - Intergenic
975433282 4:74320507-74320529 CCTAAGCAGCAGCAGCAGTTGGG - Intergenic
975496119 4:75037666-75037688 CCTTTTAACCAGCAGCAGTGTGG + Intronic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
976932763 4:90588925-90588947 CTTTATCAGCAGCATGAGAATGG + Intronic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
979464493 4:121021246-121021268 CTTTATCAGCAGCATGAAAGTGG - Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
980005962 4:127542724-127542746 CGTGAACAGCAGCTGCAGTGAGG + Intergenic
980352531 4:131700547-131700569 CTTTATCAGCAGCATGAATATGG - Intergenic
980727736 4:136787053-136787075 CTTTATCAGCAGCATGAATGTGG + Intergenic
981695736 4:147557102-147557124 TTTTATCAGCAGACACAGTGAGG + Intergenic
982050789 4:151499601-151499623 CTTTATTAGCAGCATGAGAGTGG - Intronic
984571285 4:181397395-181397417 CTTTATTAGCAGCATGAGAGTGG - Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984841409 4:184071358-184071380 CTTTATCAGCAGCATGAGAATGG - Intergenic
985110139 4:186539924-186539946 CTTTATCAGCAGCATGAGAATGG - Intronic
986153190 5:5146657-5146679 CTAGAACAGCAGCAGCAGGGTGG - Intronic
986640456 5:9867284-9867306 CTTTATTAGCAGCATGAGAGTGG - Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
987422595 5:17737918-17737940 CTTTATCAGCAGCACGAGAACGG + Intergenic
987680665 5:21132652-21132674 CTTTATCAGCAGCATGAGAATGG + Intergenic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
987806527 5:22776096-22776118 CTTTGTCAGCAGCATGAATGCGG + Intronic
988834975 5:35023242-35023264 CTTTATCAGCAGCATGAGAAAGG + Intronic
990369333 5:55101553-55101575 CATTTTCAGTAACAGCAGTGAGG - Intergenic
992879728 5:81095501-81095523 CTTGATCAGCAGCGCCAGTTGGG + Intronic
994440906 5:99801438-99801460 ATTTATCAGCATCAGCAGCATGG - Intergenic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
994993546 5:107029876-107029898 GTTTATCAGAGGCAGCACTGGGG - Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995078311 5:108014737-108014759 CTTTATCAGCAGCATGAAAGCGG - Intronic
995651061 5:114368838-114368860 GTTTATCCTCAGCAGCAGTAGGG + Intronic
995935206 5:117502827-117502849 CTTTATAACCAGCAGCTGTCTGG + Intergenic
997056507 5:130451080-130451102 CTTTATCAGCAGCATTAATATGG - Intergenic
997615147 5:135240991-135241013 CTTTATCTGCTGCTGCACTGTGG + Intronic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
997924713 5:138019017-138019039 CTTGATGAGCTGCAGCAGGGAGG - Exonic
997947034 5:138212044-138212066 CTTTATTAGCAGCACCAATGTGG - Intronic
998805535 5:145914759-145914781 CCTTCTCACCAGCAGCAGAGTGG + Intergenic
1001694827 5:173662137-173662159 CTTTATCAGCAGCATGAGAATGG - Intergenic
1001795388 5:174498110-174498132 CTTTATCAGCAGCATAAAAGTGG + Intergenic
1002292467 5:178209360-178209382 GTCTATCAGCAGCAGCAGTATGG + Exonic
1002961893 6:1923174-1923196 CTTTATCAGCAGCATGAGAACGG + Intronic
1002985097 6:2182077-2182099 CTTTATCCACATCAGCAGTAAGG - Intronic
1003952283 6:11127464-11127486 CTTTATCAGCAGCATGAAAGTGG - Intronic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004346906 6:14857294-14857316 CTTCAGCAACAACAGCAGTGAGG - Intergenic
1008565636 6:52765503-52765525 CTCTATCAGCACCAGTAGGGAGG + Intergenic
1008569826 6:52805842-52805864 CTCTATCAGCACCAGTAGGGAGG + Intergenic
1009518023 6:64643914-64643936 CTTTATCAGCAGCGTGAGAGTGG + Intronic
1010003688 6:70972904-70972926 CTTTATCAGCAGCATGAGAATGG + Intergenic
1010305519 6:74316936-74316958 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1010783989 6:79978532-79978554 CTTGATCTGCACCAGCATTGAGG + Intergenic
1011300004 6:85863920-85863942 CTTTAACAGCAGTGGGAGTGGGG + Intergenic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1013589929 6:111611379-111611401 CTTTATCAGCAGCATCAAAATGG - Intergenic
1013650946 6:112193806-112193828 CATTTATAGCAGCAGCAGTGTGG - Intronic
1014327706 6:120019254-120019276 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1014691848 6:124571671-124571693 CTTTATCAGCAGCACGAATACGG + Intronic
1014854392 6:126381659-126381681 TGTCAGCAGCAGCAGCAGTGCGG - Intergenic
1015357597 6:132297392-132297414 CTTTATCCCCTGCAGAAGTGTGG - Intronic
1016437437 6:144051590-144051612 CTTTATCAGCAGCATGAAAGAGG - Intronic
1016718003 6:147256194-147256216 CTTATGGAGCAGCAGCAGTGGGG - Intronic
1016920640 6:149289647-149289669 TTTTTTCATCAACAGCAGTGAGG - Intronic
1016935596 6:149447132-149447154 CTTTTCCAGGAGAAGCAGTGAGG - Intergenic
1017182862 6:151570845-151570867 TTTAATTAGCAGCAACAGTGGGG + Intronic
1017509503 6:155101338-155101360 CTTTTTCATCAGAAACAGTGTGG + Intronic
1017694337 6:156999561-156999583 CTTCATCACTAGCATCAGTGTGG - Intronic
1017753316 6:157509071-157509093 CTTTCACTCCAGCAGCAGTGGGG + Intronic
1018029340 6:159829903-159829925 CATCTTCAGCAGCAGCAATGTGG + Intergenic
1018031902 6:159848056-159848078 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1018381453 6:163261491-163261513 CATTATCACCAGCAGCAATTTGG + Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021170497 7:17393519-17393541 CTTTATCAGCAGCAGCAACATGG - Intergenic
1021679422 7:23115083-23115105 CTTCTTCAGCAGCTGCAATGTGG + Intronic
1023521809 7:41056952-41056974 CTTTATCAGCAGGAGAGATGAGG + Intergenic
1026051467 7:66950576-66950598 CTTTATCAGCAGCATGAGAAAGG + Intronic
1027557328 7:79681904-79681926 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1028046064 7:86120447-86120469 TGTTTTCAGCAGCAGCAGTTTGG + Intergenic
1028108695 7:86912155-86912177 CTTTAGCAACCTCAGCAGTGTGG - Exonic
1028795032 7:94893041-94893063 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1030156617 7:106461735-106461757 CTTTCACAGCAGCAACACTGCGG + Intergenic
1030195716 7:106851640-106851662 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1030798066 7:113814456-113814478 CTTTATCACCACCATCAGTCAGG - Intergenic
1031778349 7:125930758-125930780 CTTTATCAGCAGCATGAGAAAGG - Intergenic
1031785952 7:126032643-126032665 CTTTAGCAGCATCAGCAATGTGG + Intergenic
1032703973 7:134406183-134406205 CTTTATCAGCAGCATGAGAATGG + Intergenic
1033048407 7:137982727-137982749 CTTTATCAGCAGCATGAGAACGG + Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033291938 7:140092864-140092886 CTTTATGACCAGCTACAGTGAGG + Intronic
1033656174 7:143376144-143376166 CCGGATCAGAAGCAGCAGTGAGG - Intergenic
1033667202 7:143452754-143452776 CATGATCAGCTGCAGCAGTTGGG + Intergenic
1034029231 7:147741873-147741895 CTTTATCAGCAGCATGAGAATGG - Intronic
1035081715 7:156221828-156221850 CTTTATCAGAGGCTGCAGTAAGG + Intergenic
1036464173 8:8980761-8980783 CTTTATCACATGCAGCAATGGGG - Intergenic
1037178527 8:15975059-15975081 CTTTATCAGCAGCATGAGAACGG + Intergenic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1038776876 8:30539321-30539343 TGTCATCACCAGCAGCAGTGGGG + Intronic
1038913490 8:31993693-31993715 CTTTATCAGCAGCATGAGAATGG + Intronic
1039029412 8:33293506-33293528 CTTTATCAGCAGCATGAGAATGG - Intergenic
1039071530 8:33653175-33653197 CTTTATTAGCAGCATGAGAGTGG + Intergenic
1041869370 8:62615821-62615843 CCCTGGCAGCAGCAGCAGTGTGG - Intronic
1042050410 8:64698316-64698338 CTTTAGCTCCAGCAGCAGGGGGG + Intronic
1042643516 8:70960541-70960563 CCTTATCAGCAACTGCAGTGGGG - Intergenic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1044760547 8:95513461-95513483 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1045895636 8:107212754-107212776 CTTTAACAGCCACAGAAGTGAGG - Intergenic
1046600687 8:116314242-116314264 CTTTATCAGCAGCATGAGAATGG - Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1047794821 8:128243775-128243797 CTTTATCAGCAGCATAAATAAGG + Intergenic
1047894798 8:129354582-129354604 CTATATAAGAGGCAGCAGTGTGG - Intergenic
1048571261 8:135659015-135659037 CTTTGGCAGCAGCAGAACTGTGG - Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049330176 8:142046250-142046272 CTTTGTCAGCAGCCACACTGGGG + Intergenic
1049345800 8:142137921-142137943 CGTAAGCAGCAGCAGCAGTAGGG - Intergenic
1049681550 8:143920813-143920835 CTCTACCAGCAGCTGCAGCGAGG - Exonic
1050099259 9:2100808-2100830 CTTTATCAGCAGCATCAAACTGG - Intronic
1050214257 9:3304813-3304835 CTTTATCAGCAGCATGAGAACGG + Intronic
1051053730 9:12958930-12958952 CTTTAGCTGCAGAGGCAGTGTGG + Intergenic
1051160287 9:14200008-14200030 CTCTGTTAGCAGCAGCAGTAAGG - Intronic
1051263809 9:15291511-15291533 CTTTATCAGCAGCATGAGAACGG + Intronic
1052085269 9:24257386-24257408 CTTGATCAACAGCAGAAGTAAGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1054990104 9:71315375-71315397 TTTTATAAGCATCAGTAGTGGGG + Intronic
1055769008 9:79696061-79696083 GCTTTTCAGCAGCAGCAATGTGG + Intronic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1057908915 9:99003454-99003476 ATTTAGCAGCAACAGCAGCGGGG + Exonic
1058725269 9:107797322-107797344 CTTTATCAGCAGCATGAGAACGG - Intergenic
1185700050 X:2223922-2223944 CTTTGTCCAGAGCAGCAGTGTGG - Intronic
1186066966 X:5776693-5776715 CTTTATCAGCAGCATGAATATGG - Intergenic
1186167306 X:6840327-6840349 CTTTATCAGCAGCATGAGAATGG + Intergenic
1187009033 X:15261213-15261235 CATTATCAGCACCAACAGGGTGG - Intronic
1187748076 X:22431499-22431521 CTTTTGCAGCAGCAGCATTCTGG - Intergenic
1187960417 X:24562313-24562335 CTCTATCAGCAGCATGAGCGAGG - Exonic
1189192390 X:39121867-39121889 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1189371167 X:40430680-40430702 CTTTATCAGCAGCATCAAAACGG + Intergenic
1189464607 X:41268882-41268904 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1190876238 X:54462194-54462216 CTTTTTCAGCAGGAGGAATGAGG + Intronic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1193025035 X:76837927-76837949 CTTTATTAGCAGCATCAGAATGG - Intergenic
1193320282 X:80113973-80113995 CTTTATCAGCAGCAAGAAAGTGG + Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1193449341 X:81646401-81646423 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1194300746 X:92182832-92182854 CTTTATCAGCAGCATGAAAGTGG + Intronic
1196554840 X:117074307-117074329 CTTTATTAGCAGCATGAGAGTGG - Intergenic
1196600915 X:117601048-117601070 CTTTATCAGCAGCATGAATATGG - Intergenic
1197172043 X:123445020-123445042 CTTTATCTACATCAGCAGTTGGG + Intronic
1197313557 X:124936085-124936107 TTTAATCAGGGGCAGCAGTGGGG - Intronic
1197826187 X:130592942-130592964 TTTTATCACCAGCTGCAGTAAGG - Intergenic
1199015233 X:142807170-142807192 CTTTATCAGCAGCATCAAAATGG - Intergenic
1199529597 X:148831570-148831592 CCTTATCTGCAGCAGCAGTGGGG - Intronic