ID: 997921670

View in Genome Browser
Species Human (GRCh38)
Location 5:137985730-137985752
Sequence GACACTGTAGTGTCTAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997921670 Original CRISPR GACACTGTAGTGTCTAGTAC TGG (reversed) Intronic
901563683 1:10094194-10094216 GAAACTGTAGTCACTAGTACAGG - Intronic
903723868 1:25426730-25426752 TTCACTGTAGTGTTTAGAACAGG - Intronic
906564774 1:46791059-46791081 GAAACTGGAGTGTCAAGTGCAGG - Intronic
907578728 1:55552700-55552722 GAAACTGTAATTCCTAGTACAGG + Intergenic
909268313 1:73590949-73590971 CACAGTGTATTGTCTAGTCCAGG + Intergenic
918146263 1:181758635-181758657 GACACTCTGGTGTGTGGTACAGG - Intronic
923007531 1:230063537-230063559 GTCACTGTAGTTTCTAGACCTGG - Intronic
1065113585 10:22463066-22463088 GCCACTGTAAGGTCTAGAACAGG - Intergenic
1070292856 10:75132359-75132381 GACACTTGAGTGTCTAGAATTGG + Intronic
1076060858 10:127412944-127412966 GACACTGTAGTGACCAGTCCTGG - Intronic
1100664131 12:96732272-96732294 CACACTGTAGTGTGTGCTACTGG + Intronic
1106482091 13:30144248-30144270 GACAATGTAGTCTTTAATACAGG + Intergenic
1108997557 13:56753363-56753385 GAGACTGTAGTCTCAGGTACTGG + Intergenic
1118934686 14:70276342-70276364 GACAATGCACTGTCTAGGACTGG - Intergenic
1119804478 14:77473981-77474003 GACAGTGGAGTGTCTAGTTGGGG + Intergenic
1131082296 15:89546901-89546923 GACAGTTTATTGTCTAGTAGGGG - Intergenic
1133229021 16:4357727-4357749 CACACTGTGGTGTCTAGGGCAGG - Intronic
1134262262 16:12661231-12661253 TACACCGTAGTGTCTTTTACAGG + Exonic
1137727074 16:50664140-50664162 GACAGTGTAGACTCTAGTCCAGG - Intergenic
1137928752 16:52566498-52566520 GAATCTGTAGGGTATAGTACGGG + Intergenic
1142979931 17:3665832-3665854 GAGACTGGAGTGTCCAGTGCAGG + Intronic
1146118058 17:30160759-30160781 GACACTGTACTGGATACTACTGG + Intronic
1151261243 17:72917553-72917575 GACACTGAAATGTCTAGAAATGG + Intronic
1165017420 19:32891021-32891043 GACACTGTAGGGTAGAGTGCTGG - Intronic
1166379403 19:42347990-42348012 GACACTGAAGTGTCCAGTCCTGG + Intronic
1168263568 19:55209086-55209108 GACACTGTCGTGTCTGCTGCGGG - Intronic
932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG + Intergenic
932675636 2:73778667-73778689 GGCACTTTAGTATCTGGTACTGG - Intronic
936396263 2:112134155-112134177 GAGAATGTAGTGCCTGGTACAGG + Intergenic
937701247 2:124865514-124865536 GCCAGTGTAGTGCCTAGTGCTGG + Intronic
938099394 2:128487928-128487950 CACACTGTTCTGTCTAGCACTGG + Intergenic
939595704 2:144119898-144119920 AACACTGTAGTTTCTAGGGCAGG - Intronic
1174740031 20:53003961-53003983 GACACTGAAGCTTCTAGAACAGG - Intronic
1183641405 22:39095145-39095167 GACCCTGTGGTGTCTAGGACGGG - Intergenic
1185243329 22:49758679-49758701 GACACTGCAGTGTATTGTCCTGG - Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
959749847 3:109820566-109820588 GAAACTTTAATGTGTAGTACAGG + Intergenic
961618239 3:128200867-128200889 GACACTGTAGGGTCAAGTGGAGG + Intronic
962783806 3:138746744-138746766 GAAACTGAAGGATCTAGTACAGG - Intronic
963782611 3:149502001-149502023 GTCAATGGAGTGCCTAGTACAGG + Intronic
965285759 3:166817729-166817751 GACAGTGTAGTATGTAGTAGTGG - Intergenic
966988596 3:185205338-185205360 GACACTAGAGTCTCTACTACAGG - Intronic
974741879 4:66017609-66017631 AACACTGTATTGTCAAATACAGG - Intergenic
976823080 4:89229026-89229048 TACACTGTAGTTCCTAGTATGGG + Intergenic
980877065 4:138672401-138672423 GACCCTGTAGTGCCAAGTCCAGG + Intergenic
981146178 4:141327493-141327515 GACACTGTTGAACCTAGTACAGG + Intergenic
982595426 4:157377504-157377526 GAGACTGTAGTATCTAGAAGTGG + Intergenic
990484740 5:56247047-56247069 GACATTGTGGTGACTAGAACAGG + Intergenic
990491409 5:56306603-56306625 GACACTGTAGTCTTTAGCACGGG - Intergenic
992567232 5:78010122-78010144 GACAGTGTATTGTCCATTACGGG - Intronic
993858720 5:93107639-93107661 GACAATGTAGTGTCTCGCACAGG + Intergenic
996702945 5:126467855-126467877 TACACTGTAGTGGCTAGAAGAGG + Intronic
997921670 5:137985730-137985752 GACACTGTAGTGTCTAGTACTGG - Intronic
1001289848 5:170449229-170449251 GAGTCTGAAGTGTCCAGTACGGG - Intronic
1005210429 6:23454306-23454328 GACACCGTAGTGTGATGTACTGG + Intergenic
1010773919 6:79863545-79863567 GACACTTTAGGGTATAGGACAGG + Intergenic
1011260787 6:85467559-85467581 GAAACTGTACTGTTTAGCACTGG - Intronic
1020269419 7:6584851-6584873 GGAACTGTGGTGTCCAGTACAGG - Intronic
1022652725 7:32292099-32292121 GAAACTGTAGCTTCTAGCACAGG - Intronic
1025209021 7:57010139-57010161 TAGATTGTAGTGTCTAGCACCGG + Intergenic
1025276703 7:57588388-57588410 GAAACTGTAATATCTAGTATTGG - Intergenic
1025662929 7:63566717-63566739 TAGATTGTAGTGTCTAGCACCGG - Intergenic
1040658175 8:49537192-49537214 GACACTGTTGTGTCTGATTCTGG + Exonic
1044218774 8:89645623-89645645 GATACTGTAGTGACTGATACAGG - Intergenic
1049990420 9:985640-985662 GGCGCTATGGTGTCTAGTACTGG - Intronic
1050738961 9:8797817-8797839 TTCACTTTAGTGTCTAGAACAGG + Intronic
1187144494 X:16625486-16625508 CACACAGTAGTGTCTAGGAGTGG + Intronic
1196124217 X:112082333-112082355 GACACTGTAGTGTGAAGGAGAGG + Exonic
1199574584 X:149301137-149301159 GCCACTGCAGAGTCTAGAACAGG + Intergenic