ID: 997922930

View in Genome Browser
Species Human (GRCh38)
Location 5:137999802-137999824
Sequence CTGTGTTACCACTGAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997922928_997922930 -4 Left 997922928 5:137999783-137999805 CCCATTGATAGACTTTTCACTGT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 997922930 5:137999802-137999824 CTGTGTTACCACTGAGTGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 154
997922929_997922930 -5 Left 997922929 5:137999784-137999806 CCATTGATAGACTTTTCACTGTG 0: 1
1: 0
2: 1
3: 20
4: 207
Right 997922930 5:137999802-137999824 CTGTGTTACCACTGAGTGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997922930 Original CRISPR CTGTGTTACCACTGAGTGAA AGG Intronic
901625841 1:10624545-10624567 CTGTGTAACCACTGTGAGACTGG - Intronic
901645089 1:10712646-10712668 CTGTGTGATCACTGAGGGAGAGG + Intronic
905938133 1:41840932-41840954 CTGTTTAACCACTGACTGGATGG - Intronic
906590266 1:47018368-47018390 CTGTTTCAGCACTGACTGAATGG - Intergenic
908483424 1:64566514-64566536 CTGTCTTACCACAGAATGGAAGG + Intronic
908677606 1:66623075-66623097 CTGTGTTAAAATTGAGTGAAGGG - Intronic
908887064 1:68801590-68801612 CTGTTTTAGCACTGACTGAGTGG + Intergenic
909190015 1:72539613-72539635 CTGTGTGACAACTAACTGAAGGG - Intergenic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
910537441 1:88314498-88314520 CTGGGTTACAGCAGAGTGAAGGG - Intergenic
911114386 1:94231087-94231109 CTGTGTTACCATTAACAGAAAGG + Intronic
911924018 1:103803695-103803717 CTCTGATACCACTTAGGGAAGGG - Intergenic
913097589 1:115534295-115534317 CTGTTTCAGCACTGACTGAATGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915655554 1:157356882-157356904 CTGTTTTAGCACTGAGTGAGTGG + Intergenic
916914547 1:169392056-169392078 CTGTTTCACTACTGACTGAAGGG - Intronic
918637727 1:186798470-186798492 TGGTGTTACCTCTCAGTGAATGG + Intergenic
1065664909 10:28048655-28048677 GTGTGTGACCACTGAGCAAAAGG + Intergenic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1072552370 10:96488557-96488579 CTGTGTCCCCTCTGAGTGAAGGG - Intronic
1073230010 10:101961149-101961171 TTGTGTTGCCAGTGAGTGACAGG - Intronic
1073931453 10:108581464-108581486 CTGTGTTCCCGCTGTGTGCAAGG + Intergenic
1076177872 10:128382605-128382627 CTGTGCTCCCACAGAGTGAACGG + Intergenic
1076259628 10:129055139-129055161 CTTTGTCACCAGTGAGTGCAGGG - Intergenic
1077388918 11:2290303-2290325 CTGAGTTGCCACTGACTGCAGGG - Intergenic
1078543447 11:12229393-12229415 CCATGTTCCCACTGAGTAAATGG + Intronic
1078705180 11:13736942-13736964 CTGGGTTATCACAGAGTAAATGG + Intergenic
1083992711 11:66256961-66256983 CTGCGGTAGGACTGAGTGAAGGG + Intergenic
1087162767 11:94965773-94965795 CTGTGTGACCACTCATGGAAGGG + Intronic
1087505518 11:99015839-99015861 CTGTTTTGCCACTGAGTGTAAGG + Intergenic
1094178789 12:27568946-27568968 CTCTGTTACCACAGAGAAAAAGG + Intronic
1098600393 12:72324433-72324455 CGTTTTTACCTCTGAGTGAAAGG - Intronic
1099012532 12:77309114-77309136 TTGTGTTAGCACTGAGGGAACGG + Intergenic
1100765774 12:97863855-97863877 CTGTGATATCACACAGTGAAAGG - Intergenic
1102188459 12:110967561-110967583 ATGTGTTACAAATGAGGGAATGG - Intergenic
1104489113 12:129178955-129178977 CTCTGGGACCACTGTGTGAATGG + Intronic
1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG + Intronic
1109232037 13:59769238-59769260 CTGGTATACCACTGAGTGACTGG - Intronic
1112982342 13:105400598-105400620 CTATTTTTCCAGTGAGTGAAGGG + Intergenic
1113096269 13:106667153-106667175 CTCTGTGACCACAGAGGGAAAGG - Intergenic
1114515771 14:23299314-23299336 CTTCCTTATCACTGAGTGAAAGG - Intronic
1114615004 14:24063563-24063585 CTCTGGTGTCACTGAGTGAAGGG - Intronic
1116525305 14:45896779-45896801 CTGTGTCTCCACAGAGTGGAAGG - Intergenic
1116681842 14:47981853-47981875 GTGTGTGAACACTGAATGAAAGG - Intergenic
1118237445 14:64021383-64021405 CAGTGCTGCCACTGAGTGCATGG - Exonic
1119218419 14:72886907-72886929 CTGTGTTACTGCTGAGGAAATGG - Intronic
1119996543 14:79259976-79259998 CTCTGGCACAACTGAGTGAATGG - Intronic
1120312003 14:82840860-82840882 CTGTGGTATCACAGAATGAATGG + Intergenic
1120403739 14:84067912-84067934 CTTCGTTACTACTGAGTTAATGG - Intergenic
1121314852 14:92954878-92954900 CTGGGATACCACTGGGTGAGGGG - Intronic
1121793421 14:96716506-96716528 CTGTGTGATCACTGAACGAATGG - Intergenic
1122530725 14:102424727-102424749 CTGTGTGAGTACTCAGTGAATGG + Intronic
1133532409 16:6667246-6667268 CTGGGTTACCACTGTGTCCATGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1143102635 17:4512878-4512900 TTGTGTTCCCCCTGAGGGAAAGG + Intronic
1148259920 17:46172461-46172483 ATTTGTTACCACAGATTGAAAGG + Intronic
1149534983 17:57426452-57426474 CTGGGTGACTACTGAGTGTAGGG - Intronic
1150736558 17:67745236-67745258 CTGTATTACCGCTGAGCAAAAGG - Intergenic
1156729562 18:40175162-40175184 CTGTGTTCTCACACAGTGAAAGG + Intergenic
1159517106 18:69471616-69471638 CTGTGTTACAACTGGGTGGGGGG + Intronic
1167317037 19:48770275-48770297 CTGTGTTTCCACTTGGTGAAAGG - Intergenic
1168287171 19:55340654-55340676 CTGGGTGTCCAGTGAGTGAAGGG - Intronic
925928918 2:8692016-8692038 CGCTGTCACCACTGAGTGACAGG + Intergenic
925993080 2:9269451-9269473 CTGTGTCACCACAGGCTGAATGG - Intronic
926082821 2:10002798-10002820 CTCTGGAAGCACTGAGTGAACGG - Intergenic
928133538 2:28670933-28670955 CTGAGTTAGCACTGAGTGCAAGG + Intergenic
930557677 2:52919812-52919834 CTGTGTTCTCACAGAGTGGAAGG - Intergenic
931658179 2:64529486-64529508 CTGTGGTAGAACTGAGTAAAAGG - Intronic
932554266 2:72806120-72806142 CTGTGTCACCACCTAGTGATGGG - Intronic
933197307 2:79406783-79406805 CTGTGTTTCCTCTGCTTGAAAGG - Intronic
933940160 2:87238592-87238614 CTGTGTGCCCACTGGGTGGAGGG - Intergenic
935403225 2:102682107-102682129 CATGGTTACCACTGAGTGGAAGG + Intronic
936352980 2:111727186-111727208 CTGTGTGCCCACTGGGTGGAGGG + Intergenic
937445141 2:121951031-121951053 GTCTGTTTCCACTGACTGAAAGG + Intergenic
937453179 2:122019161-122019183 CTGTGTTTCCAGTGAGGAAATGG - Intergenic
939137269 2:138312397-138312419 CTGTGTTAGAAATGAGAGAATGG - Intergenic
939366109 2:141233173-141233195 CTGTGTCAACACTTAGTGAGAGG + Intronic
942946521 2:181679992-181680014 CTGTGTTTTCAGTGAATGAAAGG - Intronic
945543194 2:211114721-211114743 CTGTTTTACCCCAAAGTGAAAGG - Intergenic
948261302 2:236606311-236606333 CTGTCTTCCCACCGTGTGAACGG + Intergenic
948938956 2:241186769-241186791 TTGTGTTACTTCTGAGGGAAAGG - Intergenic
1169825974 20:9769076-9769098 CTGTGTTCTCACTGTGTTAAAGG - Intronic
1173320967 20:41986562-41986584 CTGAATAACCACTGAGTGAGAGG + Intergenic
1178430847 21:32517649-32517671 CTGTGTGTCCACTCAGTGGAAGG + Intergenic
1183774797 22:39956942-39956964 CTGTCCACCCACTGAGTGAAGGG - Intronic
1183862277 22:40678909-40678931 CTGTGTCACCTCTGAGTGCCAGG + Exonic
1184477031 22:44727535-44727557 CGTTGTTAGCACTGAATGAATGG + Intronic
1184848306 22:47102470-47102492 CTGTTTTCCCACTGAGTGCTGGG + Intronic
951084044 3:18489645-18489667 CTGTGTTTTCCCTGACTGAAAGG - Intergenic
951749426 3:26017422-26017444 TTGTGTTAGCTCTGAGTGGAAGG + Intergenic
951763711 3:26173252-26173274 ATGTAAAACCACTGAGTGAAAGG + Intergenic
953216461 3:40923260-40923282 TTGTGTTGACACAGAGTGAATGG + Intergenic
954857462 3:53658385-53658407 CTGTGTTCCCACACAGTGCAGGG - Intronic
955159693 3:56452242-56452264 ATGTGTTCTCACTGGGTGAAAGG + Intronic
957107436 3:75907694-75907716 ATGAGTTAACACTGAGAGAAAGG + Intronic
957264068 3:77938335-77938357 CAGTTTTAACACTGAGTAAATGG - Intergenic
957938276 3:86971382-86971404 CTGTGTGACCACAGGATGAATGG - Intronic
958549523 3:95595028-95595050 CAGTGTTACCGCTCAGTGATAGG + Intergenic
958911974 3:100004417-100004439 CTGTGTTACCACTGAAACCAAGG + Intronic
960358975 3:116687903-116687925 CTGTGTTACCTCTGACTGAGGGG + Intronic
960436896 3:117637158-117637180 GTGTGGTACCACAGACTGAAGGG + Intergenic
963883285 3:150552109-150552131 CTTTGTCACCACTGAAAGAAAGG - Intronic
965140308 3:164824873-164824895 CTGTTTCAGCACTGACTGAATGG + Intergenic
965758903 3:172054034-172054056 CTGTTTTACCAGTGAGTAAAAGG - Intronic
967521551 3:190438359-190438381 ATGTGCTAGCACTGAGTGACGGG - Intronic
967823274 3:193858112-193858134 CTTTCTTACCACTAAGTAAATGG + Intergenic
970866247 4:20762192-20762214 CTGTGTTCCCACATAGTGGAAGG + Intronic
975005171 4:69274711-69274733 CTCTGTTAGCACAGTGTGAAAGG + Intergenic
976980081 4:91216793-91216815 CCATTTTACCAATGAGTGAAAGG + Intronic
978150797 4:105432210-105432232 CTATGTTATCATTAAGTGAATGG + Intronic
978443576 4:108759607-108759629 ATGTGTGATCACTTAGTGAATGG + Intronic
980141057 4:128917828-128917850 CCCTGTTACCACTGAGAGAAAGG + Intronic
980820297 4:138007589-138007611 AGATGTTACCACTGAGTGAAGGG + Intergenic
980875287 4:138656149-138656171 CTGTTTCAGCACTGACTGAATGG + Intergenic
982825505 4:159999450-159999472 CTGTGGTATCACTGAGTTGAGGG + Intergenic
983131359 4:164023262-164023284 CTGTGTCACCAGTGACTGAAGGG + Intronic
983171773 4:164544001-164544023 GTATGTTACCACTGAGGAAAAGG + Intergenic
987110896 5:14685618-14685640 CTGTTTGACCAGTGTGTGAAGGG + Intronic
989004571 5:36796086-36796108 CAGTATGACCACTGAGTGTATGG + Intergenic
989481269 5:41932874-41932896 CTGTGTTAACACTAAGTGGCTGG - Intronic
990658131 5:57980806-57980828 CTGTGTTTCCAGTGAATGACTGG + Intergenic
990876253 5:60489730-60489752 CTATGTTATCTCTGAGTAAAGGG - Intronic
991188785 5:63843874-63843896 GTGTGTTACCCCTGAGGGTAAGG + Intergenic
992422005 5:76615704-76615726 CTGTCTAATCACTGAGTTAAGGG + Exonic
992786834 5:80178089-80178111 ATCTGTTACAACTGAGTGAGAGG + Intronic
994903972 5:105812410-105812432 CTTTGTTACCACTTAGGCAAAGG + Intergenic
995136364 5:108684218-108684240 CTGTCTTTGCACTGACTGAATGG + Intergenic
995351472 5:111181071-111181093 CTGTGTTCCCCCTCTGTGAATGG + Intergenic
997922930 5:137999802-137999824 CTGTGTTACCACTGAGTGAAAGG + Intronic
999527895 5:152428029-152428051 CTGTCTTGCCACTGGGTGCAGGG - Intronic
1000299624 5:159944518-159944540 CTGTGTTACCATTTTGTCAAAGG + Intronic
1001018649 5:168164152-168164174 CTGTTTTGGCACTGAATGAATGG - Intronic
1001026449 5:168228206-168228228 CTCTGTTACCACAGAGTGGGAGG + Intronic
1001588573 5:172850242-172850264 CTGAGTTAACCCTGAGTCAAAGG + Intronic
1004164036 6:13239994-13240016 TTGTGTTCCCACTGGGTAAAAGG - Intronic
1004763887 6:18702206-18702228 CTTTGTTAGCCTTGAGTGAAAGG - Intergenic
1014532925 6:122580951-122580973 CTGTGCTACCACTAGGTGGATGG + Intronic
1015299414 6:131635471-131635493 CTGTTTCAGCACTGACTGAATGG + Intronic
1019116880 6:169772156-169772178 CTGTGTTACGACAAGGTGAAGGG - Intronic
1020927198 7:14345139-14345161 CTGTATTCCAAATGAGTGAAAGG + Intronic
1024986656 7:55200031-55200053 CTGTGTTACGCCTGAGGGGATGG - Intronic
1030657314 7:112182684-112182706 CTGTCTGTCCAGTGAGTGAAAGG - Intronic
1031040371 7:116832817-116832839 GTGTGTTGCCACTGACTCAAGGG - Intronic
1032741711 7:134746273-134746295 CTGTGTCCTCACAGAGTGAAGGG - Intronic
1034062990 7:148110178-148110200 CTGTTTCAGCACTGACTGAATGG - Intronic
1035285006 7:157800151-157800173 CTGTGGTACCTCTGAGGGATGGG - Intronic
1037524207 8:19708791-19708813 CGTTGTTAGCACTGAGTGGAGGG + Intronic
1038252908 8:25923018-25923040 CTCTGTGGCCTCTGAGTGAAGGG - Intronic
1038628165 8:29214823-29214845 CTGTGATGCCACTAAGTGACAGG + Intronic
1040012930 8:42677268-42677290 CTGTCTTACCAGTGAGGAAAAGG + Intergenic
1041191237 8:55357148-55357170 CTGTACTTACACTGAGTGAAAGG + Intronic
1041436411 8:57846872-57846894 CTGTGGTCCCAGTGAGTGACTGG - Intergenic
1042526398 8:69768978-69769000 CAGTGTGCCGACTGAGTGAACGG - Intronic
1044513591 8:93112525-93112547 CTGTGGTACCACAGAGTGATGGG + Intergenic
1046204889 8:110980903-110980925 CTTTGTTACCACAGCGTAAAGGG - Intergenic
1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG + Intronic
1050205236 9:3189222-3189244 CTGTGTTTCCACACAGTGGAAGG - Intergenic
1051072689 9:13191642-13191664 CACAGTTACCACTTAGTGAATGG - Intronic
1053387133 9:37701728-37701750 ATGTGTTTCCCCTGACTGAATGG - Intronic
1057057790 9:91977315-91977337 CTGTGTTCTCACTTAGTGGAAGG - Intergenic
1062293933 9:135813703-135813725 CTGTCTTGCCAGTGAGTGACTGG - Intronic
1185864242 X:3609035-3609057 CTTTGTTATCACTTAGGGAAAGG - Intronic
1189459015 X:41222014-41222036 CTGTGTTTCCCCTCAGTAAATGG - Intronic
1189920144 X:45895661-45895683 CTCTGATACCAATGTGTGAAAGG + Intergenic
1193946212 X:87738776-87738798 CTGTGTTATAACACAGTGAAAGG - Intergenic
1193974228 X:88097982-88098004 GTGTGTTACCACTGAGTCATTGG + Intergenic
1195018663 X:100803484-100803506 CAGTGTTACTACTGATGGAAAGG - Intergenic
1196093757 X:111776242-111776264 CTGTGTCACCTCTGAGAGCAAGG + Exonic
1197949736 X:131881320-131881342 CATTGTTATCACTGAGTGATGGG - Intergenic
1198587767 X:138141674-138141696 CTGTGTCACCACTGGGAAAAAGG + Intergenic
1199161176 X:144614028-144614050 CTGTATTTTCAATGAGTGAAGGG - Intergenic
1199595347 X:149502552-149502574 CGGTGTAACCACTGAGCAAAGGG + Intronic