ID: 997926337

View in Genome Browser
Species Human (GRCh38)
Location 5:138033571-138033593
Sequence TTCTCTCTGGAGTCTAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997926337_997926343 5 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926343 5:138033599-138033621 AGGCTTCGGTGCCTTAGTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 70
997926337_997926344 12 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926344 5:138033606-138033628 GGTGCCTTAGTCTGGGACTGTGG 0: 1
1: 0
2: 1
3: 14
4: 148
997926337_997926342 4 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926342 5:138033598-138033620 AAGGCTTCGGTGCCTTAGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
997926337_997926347 29 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926347 5:138033623-138033645 CTGTGGAAGTCGATAGGCTGCGG No data
997926337_997926341 -9 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926341 5:138033585-138033607 CAGAGAGAACAGTAAGGCTTCGG No data
997926337_997926348 30 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926348 5:138033624-138033646 TGTGGAAGTCGATAGGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 72
997926337_997926346 23 Left 997926337 5:138033571-138033593 CCTGACCTAGACTCCAGAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 997926346 5:138033617-138033639 CTGGGACTGTGGAAGTCGATAGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997926337 Original CRISPR TTCTCTCTGGAGTCTAGGTC AGG (reversed) Intronic
901028273 1:6290833-6290855 TGCTCTCTGAAGTCAGGGTCCGG + Intronic
903312806 1:22473002-22473024 TTCTGTCTGGAGCCAAGGGCAGG + Intronic
904505354 1:30948406-30948428 TTCTCTGTGGTGTCTTGTTCTGG - Intronic
905465869 1:38152705-38152727 TGCTGTCTGGAGTCTATTTCTGG + Intergenic
907338672 1:53717956-53717978 ATCTCTCTGGAATCACGGTCTGG - Intronic
907338868 1:53719306-53719328 TTCTCTCTTGAGTTGAGGTAAGG + Intronic
908966840 1:69775848-69775870 TTTTCTCTGAAGTCTAGTCCAGG - Intronic
915451595 1:156009215-156009237 TTCTCTCAGGGGTCTAGGAGGGG - Exonic
915917686 1:159950827-159950849 TTCTCTTTGGAGTCTTGTCCTGG - Intergenic
919564069 1:199161797-199161819 TCCTCTCTGGAGTTTAGTTTGGG - Intergenic
920230407 1:204466286-204466308 TTCTGGCGGGAGTCTAGCTCCGG + Intronic
920367364 1:205455257-205455279 GTGTCTGTGGGGTCTAGGTCTGG - Intronic
923922796 1:238587680-238587702 TTCACTTTGCAGTCTAGATCTGG - Intergenic
1063649306 10:7917622-7917644 TGCTCTCTGGAGAATAGGTCGGG + Intronic
1064423558 10:15210685-15210707 TTCTCCCTGGAGTCTTAGCCAGG + Intergenic
1067089756 10:43260561-43260583 TTCTCCGTGGGGTCTGGGTCTGG - Intronic
1068306779 10:55221241-55221263 TTGTCTCTGGAGTGGAGGTAGGG + Intronic
1068423243 10:56822671-56822693 CTCTCTCTGGTGTCTGGGCCTGG - Intergenic
1068573860 10:58661313-58661335 TTCTCTCTGGAGTTTAGAAATGG + Intronic
1069607819 10:69750890-69750912 TTCTCTCAGGAGTCAAGCTCGGG + Intergenic
1071468333 10:85961007-85961029 CTCTCTGTGGTGTCTAGGCCTGG + Intronic
1072287087 10:93926600-93926622 ATCTGTCTGGGTTCTAGGTCTGG - Intronic
1076948431 10:133666475-133666497 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076949420 10:133669785-133669807 TCCTCTCTGGGGTCTCGCTCTGG + Intronic
1076950404 10:133673084-133673106 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076951389 10:133676383-133676405 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076952379 10:133679693-133679715 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076953367 10:133683003-133683025 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076955335 10:133742654-133742676 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076956325 10:133745964-133745986 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076957313 10:133749273-133749295 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076958302 10:133752583-133752605 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076959286 10:133755882-133755904 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1076960275 10:133759192-133759214 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078098107 11:8312813-8312835 TGCTCTCTGGGGTCTAGAACAGG + Intergenic
1078452379 11:11449784-11449806 TTATCTCTGCATTCTAGGTTGGG - Intronic
1080812793 11:35722336-35722358 CCCTCTCTGGGGTCTGGGTCAGG - Intronic
1082272863 11:50191100-50191122 TTCTCTCTCTAGTCTATATCTGG - Intergenic
1084838148 11:71821254-71821276 TTTTCTCAGGACTCTAGGTTGGG - Intergenic
1085250899 11:75143196-75143218 TTCTCTCTGGTGTCTGGACCAGG - Intronic
1085741082 11:79079039-79079061 TTCTCCCAGGAGTCCAGGCCAGG - Intronic
1087156418 11:94909301-94909323 TACCCTGTGGAGTCTAGGTGGGG + Intergenic
1087531524 11:99388090-99388112 TTCCCTCTGCAGACTAGGTTTGG + Intronic
1087591780 11:100198496-100198518 TACTCACTGAGGTCTAGGTCAGG - Intronic
1091413926 12:263672-263694 TTCAGCCTGGAGTCTAGGACAGG + Intergenic
1092400555 12:8172828-8172850 TTTTCTCAGGACTCTAGGTGGGG + Intronic
1095206646 12:39446048-39446070 CTCGCTCTGGAGTCTCGCTCTGG + Intergenic
1095880956 12:47135642-47135664 TACTCTGTGAAGTCTAGGACAGG - Intronic
1095991606 12:48038285-48038307 GTCCCCTTGGAGTCTAGGTCAGG + Intergenic
1096810633 12:54167438-54167460 TACTCCCTGGAGGCTTGGTCAGG - Intronic
1097276142 12:57814741-57814763 TTATATTTGGAGTCTGGGTCAGG + Intronic
1097593798 12:61603164-61603186 TTCCCTCTGGAGTCAAAATCAGG - Intergenic
1097845891 12:64364904-64364926 TTCTCTCTGACTTCTAGGCCTGG - Intronic
1098929215 12:76391218-76391240 TTCTCTCTGGATTTTGGCTCAGG - Intronic
1100505386 12:95215495-95215517 TTCTTTCTGGTGTCTAGATGGGG - Intronic
1101317068 12:103638998-103639020 TTCTCTTTGGAGGCAAGGTTGGG - Intronic
1102454698 12:113064169-113064191 TCCTCACTGGAGACTAGGGCTGG + Intronic
1102694218 12:114785575-114785597 TTGTTTCTTGAGTCAAGGTCTGG - Intergenic
1104599258 12:130141524-130141546 CTCTCTGTGGAGTCTAGAGCAGG - Intergenic
1104841148 12:131826570-131826592 CTCTCTCTGGATTCTGGGTCAGG - Intergenic
1104926620 12:132317217-132317239 TGCTCTGTGGAGTCTAGGATGGG - Intronic
1105778627 13:23686565-23686587 CCCTCTCTGGGGTCTAGATCGGG + Intergenic
1105985043 13:25557599-25557621 TTCTCTCTGGAGACTTTGTGAGG + Intronic
1108611029 13:52083928-52083950 TTCTCTCTGGAGCAGAGGCCTGG - Intronic
1110412513 13:75220015-75220037 TTCTCTCTGGAGCCTAACTTCGG - Intergenic
1116136937 14:40937321-40937343 TTCTCCCTATAGTTTAGGTCAGG + Intergenic
1117535474 14:56698740-56698762 TTCCCTCTGGATTTTAGGTCTGG - Intronic
1119055111 14:71411489-71411511 TTCTCTCTGTAGTGGAGGTGTGG + Intronic
1121601023 14:95203034-95203056 TCCTCCCTGGAGTCCAGGTCTGG + Exonic
1121692286 14:95886495-95886517 TTTTCTGTGGAGTCTGGGCCTGG + Intergenic
1202849409 14_GL000225v1_random:7769-7791 TTCTCTCTGGGGTCTCGCTCTGG + Intergenic
1202854457 14_GL000225v1_random:42181-42203 TTCTCTCTGGGGTCTCGCTCTGG + Intergenic
1202855905 14_GL000225v1_random:52206-52228 TTCTCTCTGGGGTCTCACTCTGG + Intergenic
1202856863 14_GL000225v1_random:57481-57503 TTCTCTCTGGGGTCTCACTCTGG + Intergenic
1202858509 14_GL000225v1_random:65541-65563 TTCTCTCTGGGGTCTCGCTCTGG - Intergenic
1202859806 14_GL000225v1_random:73817-73839 TTCTCTCTGGGGTCTCGCTCTGG - Intergenic
1202860977 14_GL000225v1_random:80660-80682 TTCTCTCTGGGGTCTGGCTCTGG - Intergenic
1202862488 14_GL000225v1_random:91115-91137 TTCTCTCTGGGTTCTCGCTCTGG - Intergenic
1202863590 14_GL000225v1_random:100767-100789 TTCTCTCTGGGGTCTCGCTCTGG - Intergenic
1202921666 14_KI270723v1_random:34048-34070 TTCTCTCTGGGGTCTTGCTCTGG + Intergenic
1202923248 14_KI270724v1_random:3532-3554 TTCTCTCCGGGGTCTTGCTCTGG - Intergenic
1126312386 15:47332632-47332654 TTCACTCTGGAATCTAGCTGTGG + Intronic
1131454014 15:92569273-92569295 TTTTTTCTGGAGACAAGGTCTGG - Intergenic
1135890636 16:26353839-26353861 TTCTCTCAGGAGTCTAACTAGGG + Intergenic
1136629409 16:31480725-31480747 TTCTCCCTGGTGTCTAGAACAGG + Intergenic
1137923191 16:52512383-52512405 TTATCTCTGGAGTCAAGTTCTGG - Intronic
1141613943 16:85199675-85199697 TTCTCTCTGAAGTCTAAGTTTGG + Intergenic
1142371389 16:89684879-89684901 ATCTGAATGGAGTCTAGGTCTGG + Intronic
1142543192 17:678107-678129 TTCTCTCTTGAGACAGGGTCTGG - Intronic
1144749894 17:17641344-17641366 TTCTCTATGGAGTTGGGGTCTGG + Intergenic
1145734874 17:27221296-27221318 TTTTCTCTGTTGTCTAGTTCAGG - Intergenic
1145972996 17:28967914-28967936 TTCTCACTGGAGTCTGTTTCTGG + Intronic
1146960897 17:36977410-36977432 TTCTCTCTATAGTATGGGTCTGG - Intronic
1148885404 17:50768545-50768567 TTTTCTCAGGAGTCCAGGCCAGG - Intergenic
1149305012 17:55339399-55339421 TCACCTCTGGAGTCCAGGTCAGG - Intergenic
1150334549 17:64321047-64321069 GCCTGTCTTGAGTCTAGGTCGGG + Exonic
1150536909 17:66052481-66052503 ATGGCTGTGGAGTCTAGGTCTGG - Intronic
1151571533 17:74928366-74928388 TTCTTCCTGGATTCTGGGTCTGG - Intronic
1154361345 18:13664613-13664635 TGCTCTCTGCAGTCTTGGGCAGG - Exonic
1157131187 18:45008845-45008867 CTCTCTCTGCTGTCTAGGTTGGG + Intronic
1158106291 18:53888504-53888526 CTCACTCTGGTGTCTAGGACTGG - Intergenic
1158144562 18:54297385-54297407 TTCTGTCTTGAGTGTAGGCCTGG + Exonic
1160391016 18:78533208-78533230 TTCTCTTAGGAGTAAAGGTCTGG - Intergenic
1163217486 19:15891779-15891801 TTCTCTCACGTGTCTAGGTTTGG - Intronic
1163649327 19:18508046-18508068 TTCCCACTGGAGGCTATGTCAGG + Intronic
1164078361 19:21841468-21841490 TTCTCTCTGCAGGCAAGGCCTGG + Intronic
1164204543 19:23047301-23047323 TTCTCTCTGTAGGCAAAGTCTGG + Intergenic
1166630531 19:44402482-44402504 TTCTCTATCTAGTCTAGGACTGG - Intergenic
926162966 2:10501318-10501340 CTCTCGCTGGAGTCTGGGTGGGG + Intergenic
927853152 2:26512463-26512485 TTCTCTCCAGAGACTAGGGCAGG + Intronic
928241799 2:29592895-29592917 TTCTCCCTGGAGTCTTGGGAGGG + Intronic
931943739 2:67282206-67282228 TTCTCCCTGGAGTTAAGATCAGG - Intergenic
932268487 2:70388500-70388522 AGCTCCCTGGAGTCTAGGACTGG - Intergenic
936808848 2:116371597-116371619 TTCTCTCTGGAGCCTTGGGAGGG + Intergenic
937750464 2:125471060-125471082 TTGTCTCTGGACTGCAGGTCAGG + Intergenic
938777041 2:134551051-134551073 TTCTATCTGGGGTCCAGGGCTGG + Intronic
948617812 2:239212720-239212742 TCCTCCCTGGAGTCCAGGCCTGG - Intronic
949006953 2:241655145-241655167 TTCCGTCTGGAGGCTGGGTCGGG + Intronic
1168953754 20:1819940-1819962 GCCTCTCTGTGGTCTAGGTCAGG - Intergenic
1169367844 20:5005577-5005599 ATCTCTCTGGAGTCTAGACCTGG + Intronic
1171872021 20:30536060-30536082 TTCTCTGTCTAGTCTAGGACTGG + Intergenic
1172975705 20:38904189-38904211 TTCTGTCTGAAGTCAAGGCCAGG + Intronic
1177222536 21:18213336-18213358 TTTTGTTTGGATTCTAGGTCAGG - Intronic
1177683771 21:24410360-24410382 TGCTCCCTGGAGTCCAAGTCTGG + Intergenic
1178828939 21:36038909-36038931 TTCTTTCTAGTGTCTAGGTCTGG - Intronic
1179672437 21:42959091-42959113 TTCCCTCAGGAGTCTGGGGCTGG - Intergenic
1181632154 22:24156971-24156993 TTCTCTCTGCAGACAAGGGCTGG - Intronic
1182362749 22:29756593-29756615 TTCTCTGTGGAGTCTGAATCAGG - Intronic
1182386231 22:29943833-29943855 TTCTTTCTTGAGACAAGGTCTGG + Intronic
1182714757 22:32348514-32348536 CTCTCTCTGGGGTCTGGATCGGG - Intergenic
1183684790 22:39355466-39355488 TTCTCTCTCAGGTCTAGGACAGG + Intronic
951618566 3:24575779-24575801 CTCTATGTGGAGTCTAGGTAAGG + Intergenic
953335191 3:42088617-42088639 TTCTCTCTGGAGTCCACTGCAGG + Intronic
953812927 3:46129977-46129999 TCCTCTCTGGATTCTGAGTCTGG - Intergenic
953983888 3:47426879-47426901 GTCTCTCTTGAGCCTAGGGCAGG - Intronic
957665329 3:83218505-83218527 TTCTGTCTAGAGCCCAGGTCAGG - Intergenic
960036215 3:113105322-113105344 TTCTCTCTGGTGCCTTGGGCAGG - Intergenic
961569166 3:127785915-127785937 TATTCCCTGGAGTCTAGGTCGGG - Intronic
963387235 3:144612842-144612864 ATCTCTCTGGAGTCAAAGACAGG - Intergenic
963540202 3:146577182-146577204 TTCTATCTAGAGTTAAGGTCAGG - Intronic
963980941 3:151536200-151536222 TTCTCCTTGGAGTCAAAGTCTGG + Intergenic
967064102 3:185899124-185899146 TTCTCTCTGGAGCCAATTTCTGG - Intergenic
967280041 3:187813413-187813435 TTGTTCCTGGAGTCTAGGCCTGG - Intergenic
967312969 3:188123526-188123548 ATTTCTCTGGACTCTAAGTCTGG - Intergenic
968944023 4:3654269-3654291 TTTTCCCTGGAGGCTGGGTCTGG - Intergenic
972781911 4:42293578-42293600 CTCTCTTTGGAGTCTGGATCTGG + Intergenic
974397423 4:61356211-61356233 TTCTCATTGGTGTCTAGGTAAGG + Intronic
975546388 4:75564396-75564418 TCCTCTCTGGAGTCTTCTTCTGG - Exonic
976772053 4:88663831-88663853 TTCTCTTTGGAGTTTAGATAGGG + Intronic
979560423 4:122095673-122095695 TTCTCTCTACAGTCCAGGTAAGG - Intergenic
980534407 4:134097525-134097547 TTCACTTTGGATTCTAGTTCTGG + Intergenic
982989418 4:162252333-162252355 TTTTCTCTGGTGTCCTGGTCAGG - Intergenic
984744681 4:183202811-183202833 TGCTCTCTGGAGTCAAGGCTGGG + Intronic
985451885 4:190067280-190067302 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985452874 4:190070571-190070593 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985453861 4:190073864-190073886 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985454849 4:190077157-190077179 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985455837 4:190080454-190080476 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985456820 4:190083748-190083770 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985457808 4:190087044-190087066 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
985458796 4:190090341-190090363 TCCTCTCTGGGGTCTCGCTCTGG + Intergenic
987429223 5:17811517-17811539 TTCCCTCTGGAGGTTTGGTCTGG - Intergenic
992624946 5:78628395-78628417 TTCTCTCTGGAGAACAGGCCAGG - Intronic
992948410 5:81832515-81832537 CTCTCTCTGGAGTCTACCTGGGG + Intergenic
993725892 5:91366045-91366067 TTTTTTTTGGAGTCAAGGTCTGG - Intergenic
997926337 5:138033571-138033593 TTCTCTCTGGAGTCTAGGTCAGG - Intronic
999287887 5:150405030-150405052 TTTCCTCTGGTGTCTAGGGCAGG - Intronic
1001052218 5:168422601-168422623 TTCTTTTTGGAGACAAGGTCTGG - Intronic
1002003901 5:176216314-176216336 GTCCCACTGGAGTGTAGGTCTGG - Intergenic
1002187053 5:177459353-177459375 TCCTCTCTGGAATCTGGGTGGGG + Intronic
1002222470 5:177694292-177694314 GTCCCACTGGAGTGTAGGTCTGG + Intergenic
1002334418 5:178468211-178468233 TTCTGGCTGGAGTCTGGGTGGGG - Intronic
1005973618 6:30780432-30780454 GTCTCACTGGAGTGTAGCTCTGG + Intergenic
1011161220 6:84392570-84392592 TTCTCTCTGGATTCTAGTCATGG + Intergenic
1014653199 6:124067145-124067167 TTCTCTCTGGAGTCTGAAGCAGG + Intronic
1015459108 6:133468136-133468158 GTCTCTGTGGAGTCTAGGAGGGG + Intronic
1018447098 6:163867777-163867799 TTCTGTCTGGAGACTTCGTCTGG - Intergenic
1018540727 6:164876637-164876659 TGCTGTCTGGAGTCTTTGTCAGG + Intergenic
1021527613 7:21606309-21606331 TTTTCTCTTGAGACAAGGTCTGG - Intronic
1021867368 7:24971507-24971529 CTCTCTCTGGACTCTGGGTGTGG - Intronic
1026334179 7:69379580-69379602 ATCTCTCTGGTGTCCAGGTTGGG - Intergenic
1026966684 7:74444600-74444622 TTTTCTTTGGAGACAAGGTCCGG + Intergenic
1028901731 7:96108566-96108588 TTTTCTCTGGGGTATAGGCCAGG + Intronic
1032535463 7:132659599-132659621 CTATCTCTGGGGTCCAGGTCAGG + Intronic
1033821692 7:145142133-145142155 TTCTCACTGGATTCTGAGTCTGG - Intergenic
1034000582 7:147408258-147408280 TTCTCCCTGGGATCTAGGTTGGG + Intronic
1036277000 8:7362721-7362743 TTTTCTCAGGACTCTAGGTTGGG - Intronic
1036344333 8:7947621-7947643 TTTTCTCAGGACTCTAGGTTGGG + Intronic
1036839674 8:12108393-12108415 TTTTCTCAGGACTCTAGGTTGGG + Intronic
1036861466 8:12354633-12354655 TTTTCTCAGGACTCTAGGTTGGG + Intergenic
1044645411 8:94437484-94437506 TTTACTGTGGAGTCTGGGTCTGG - Intronic
1044899413 8:96927906-96927928 TTCTCTCTGGAATTTAATTCTGG + Intronic
1045684223 8:104694534-104694556 TTATCTCTAGAGTCTAGAACAGG - Intronic
1047344780 8:124016517-124016539 TTCTCACTGGAGAGTAGGTTTGG - Intronic
1056446466 9:86671097-86671119 TTCTCTCTGGAGTAAAGGGAGGG + Intergenic
1058803005 9:108562986-108563008 TTTGCTCTGGAGTCTATTTCTGG - Intergenic
1059508661 9:114823387-114823409 TTCTATCTGAATTCAAGGTCAGG + Intergenic
1059950927 9:119461737-119461759 TTGAATCTCGAGTCTAGGTCAGG - Intergenic
1061114478 9:128600630-128600652 TTCTCCCTGTATTCTTGGTCAGG - Intronic
1203740734 Un_GL000216v2:175245-175267 TTCTCTCTGGGGTCTCGCTCTGG + Intergenic
1186534083 X:10329330-10329352 TTCTCTGTGAAGTCTGGGTAAGG - Intergenic
1188443559 X:30234472-30234494 GACTGTCTGGAGTCAAGGTCAGG + Intronic
1195619283 X:106936927-106936949 TTCTATCTGGAGTCTGCCTCTGG + Intronic
1199466588 X:148144831-148144853 GACTCTCTGGAGTCAAGGGCTGG - Intergenic
1199594393 X:149495029-149495051 TGCTCTCTGTTGTCTAGGTGAGG - Intronic
1201176704 Y:11314300-11314322 TTCTCTCTGGTGTCTCGCTCTGG + Intergenic
1201177832 Y:11320947-11320969 TTCTCTCTGGGGTCTCCCTCTGG + Intergenic
1201179395 Y:11331722-11331744 TTCTCTCTGGGGTCTCGGTCTGG + Intergenic