ID: 997926488

View in Genome Browser
Species Human (GRCh38)
Location 5:138035108-138035130
Sequence TAGGGTAGGAATGCTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997926488_997926497 4 Left 997926488 5:138035108-138035130 CCTCCAGCAGCATTCCTACCCTA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 997926497 5:138035135-138035157 CCTGAGTAGCTGGGACTACAGGG 0: 679
1: 2404
2: 3624
3: 3967
4: 3249
997926488_997926495 3 Left 997926488 5:138035108-138035130 CCTCCAGCAGCATTCCTACCCTA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 997926495 5:138035134-138035156 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
997926488_997926493 -5 Left 997926488 5:138035108-138035130 CCTCCAGCAGCATTCCTACCCTA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 997926493 5:138035126-138035148 CCCTAGTCTCCTGAGTAGCTGGG 0: 6
1: 368
2: 10161
3: 119947
4: 222906
997926488_997926498 22 Left 997926488 5:138035108-138035130 CCTCCAGCAGCATTCCTACCCTA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 997926498 5:138035153-138035175 CAGGGACATGCCACCATGCCTGG 0: 21
1: 2413
2: 13228
3: 43457
4: 96368
997926488_997926491 -6 Left 997926488 5:138035108-138035130 CCTCCAGCAGCATTCCTACCCTA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 997926491 5:138035125-138035147 ACCCTAGTCTCCTGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997926488 Original CRISPR TAGGGTAGGAATGCTGCTGG AGG (reversed) Intronic
900577424 1:3390236-3390258 TAGGGCAAGAATGTTGGTGGTGG + Intronic
903284287 1:22267465-22267487 TTGGGCAGGGATGCTGCAGGTGG + Intergenic
904675892 1:32199103-32199125 TATGGGAGACATGCTGCTGGTGG + Intergenic
905438701 1:37978688-37978710 TGGGGTAGCACTGCTGCTTGTGG - Intronic
905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG + Intronic
908877312 1:68692114-68692136 TAGAAAAGGAAGGCTGCTGGAGG - Intergenic
909818052 1:80021766-80021788 TAGGGGAGCAATGCTGCTTTAGG + Intergenic
913720977 1:121594311-121594333 TGGGTTAGGAATGCTGAGGGGGG + Intergenic
914753561 1:150550872-150550894 AAGGGTAGGAATGTGCCTGGGGG - Intronic
915712208 1:157910839-157910861 TAGGCACTGAATGCTGCTGGTGG - Intergenic
915971589 1:160358791-160358813 TAGGGTGGGCGTGCTGCGGGTGG + Exonic
918623630 1:186633579-186633601 TGGGTTAGGAATGCAGCTGGTGG + Intergenic
921659710 1:217787066-217787088 TAGGATATGGATGATGCTGGAGG - Intronic
1063454054 10:6170750-6170772 CAGAGCAGGAAAGCTGCTGGGGG + Intronic
1063621714 10:7655218-7655240 TAGGCTCTCAATGCTGCTGGAGG - Intronic
1067054142 10:43041526-43041548 CAGGTGAGGGATGCTGCTGGTGG - Intergenic
1067134859 10:43598846-43598868 GAGGGTGGGGCTGCTGCTGGGGG + Intergenic
1067848946 10:49743094-49743116 GAGGGCAGGGATGCTGCAGGAGG + Intronic
1069363083 10:67666347-67666369 TAGGGAAGGAATGCAGTAGGGGG - Intronic
1069993416 10:72328695-72328717 GAGGCTGGGAATGCTGCAGGTGG + Intergenic
1074252986 10:111772166-111772188 GGGGGTAGGCATGCAGCTGGAGG - Intergenic
1076700318 10:132269582-132269604 AAGGGCAGGAAGGCTGCTCGGGG + Intronic
1077043289 11:533932-533954 TCCGGTAGGAATCCTGCAGGAGG + Exonic
1077431514 11:2518141-2518163 GAGGGAGGGAATGCAGCTGGTGG + Intronic
1077899644 11:6478377-6478399 TGGGGTAGGAATGTGGGTGGTGG + Intronic
1078055194 11:8003557-8003579 TAGGGTGGGCAGGCAGCTGGGGG - Intergenic
1081623359 11:44632240-44632262 TGGGGAAGGAATGCAGCTGGGGG + Intergenic
1084030579 11:66478353-66478375 GAGGGTGGGGATGCTGCAGGAGG + Intergenic
1084045169 11:66564038-66564060 CAGGGTAGGATGGCGGCTGGAGG + Intronic
1085413374 11:76305155-76305177 TGGGGTAGGGATGCGGGTGGTGG - Intergenic
1089030444 11:115321801-115321823 TAGGGTTAGAGTGCTGCTTGAGG + Intronic
1089918514 11:122183976-122183998 TAGGGTAGTAATGCTGCTTGGGG - Intergenic
1090349935 11:126101454-126101476 TAGCCCAGGAATGCAGCTGGGGG - Intergenic
1090661865 11:128888257-128888279 AAGGGAAGGGTTGCTGCTGGGGG - Intergenic
1091190719 11:133693411-133693433 TAGGCCAGGAATGATGCAGGTGG - Intergenic
1095558990 12:43543065-43543087 TGAGGCAGGAATGCTGCTTGAGG + Intronic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1102988395 12:117297248-117297270 TGGGGTTGGAATGCAGCTGCAGG + Intronic
1103635697 12:122303403-122303425 TAAGGTAGGAAGGGTGTTGGGGG - Intronic
1104751126 12:131239830-131239852 TAGAGTTTGAATGCCGCTGGAGG - Intergenic
1107459027 13:40583346-40583368 TAGGGGGGTAATGCAGCTGGTGG - Intronic
1107524822 13:41220031-41220053 TAGGACAGGAAAACTGCTGGGGG + Intronic
1108483913 13:50905828-50905850 AAGGGAAGGAATGATGCTTGTGG + Intergenic
1113423429 13:110187617-110187639 TAGGGTAAGAAAACTCCTGGAGG - Intronic
1113823541 13:113232430-113232452 CAGGGCAGGAGTGGTGCTGGTGG - Intronic
1115532879 14:34343159-34343181 TATGGTTGGAATGTTTCTGGTGG + Intronic
1115653068 14:35417185-35417207 TAGGTTAGGCATGAGGCTGGTGG + Intergenic
1117179866 14:53180989-53181011 TAGGGAAAGAAAGCTGCAGGGGG - Intergenic
1117344565 14:54819655-54819677 TCTGGGAGGAATGCAGCTGGAGG - Intergenic
1122717491 14:103704264-103704286 AAGGGGAGGCAGGCTGCTGGGGG + Intronic
1122834524 14:104424299-104424321 TCGGGGAAGAATCCTGCTGGGGG + Intergenic
1124242100 15:28037263-28037285 GAGGGCAGGAAGGCAGCTGGTGG + Intronic
1124420108 15:29513709-29513731 TTGGGTGGGAATGCTCCTTGTGG - Intronic
1125002862 15:34789490-34789512 TATGGTGGGAAGGCTGCTAGGGG - Exonic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1127996913 15:64158515-64158537 TAGGGCAGGCAGGCTGCTGGGGG - Intronic
1128874238 15:71189172-71189194 GAGGGTAGGAGAACTGCTGGAGG + Intronic
1128894774 15:71362743-71362765 TAGGGTGGGAGTGCTGCGTGCGG - Intronic
1129189099 15:73927284-73927306 GCGGGTAGGAGGGCTGCTGGCGG - Exonic
1129519408 15:76176474-76176496 TAAGGTGGGAATGCTACTGAGGG + Intronic
1130960568 15:88656211-88656233 TAGGACAGGCATGGTGCTGGGGG - Exonic
1130985592 15:88842628-88842650 TGGGGTGGGAATGCGGCAGGGGG - Intronic
1131458510 15:92602098-92602120 CAGGGGAAGAATGCTGGTGGAGG - Intergenic
1132393105 15:101453252-101453274 TGGGGTAGGGAGGCTGCTTGAGG + Intronic
1133076729 16:3285780-3285802 CAGGGGAGGAAGGGTGCTGGGGG - Intronic
1136609895 16:31359840-31359862 TGGGGGAGGGAGGCTGCTGGGGG + Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1142065336 16:88059202-88059224 GAGAGTAGGGATGCTCCTGGAGG + Intronic
1143634950 17:8159281-8159303 AAGGGTAGGAGAGATGCTGGAGG - Exonic
1145839588 17:27983416-27983438 TAGGGTAGGAGTGATGCGGTGGG - Intergenic
1147359396 17:39921665-39921687 TAGGGGAGGGAGGCTGCTGTGGG - Intronic
1148897489 17:50847664-50847686 TATGGTAGGGGTGCTGCTGATGG + Intergenic
1149905931 17:60526276-60526298 GAGGGGAGGAATGCGGCAGGCGG + Intergenic
1150582503 17:66487631-66487653 GAAGGCAGGGATGCTGCTGGTGG - Intronic
1152899478 17:82931847-82931869 TAGCTTTGGAAAGCTGCTGGAGG + Intronic
1156516095 18:37681862-37681884 AAGGGTATGGATGCTGCAGGTGG + Intergenic
1158908379 18:62036042-62036064 AAATGTAGGCATGCTGCTGGAGG - Intergenic
1164656089 19:29923054-29923076 GAGGGCTGGAGTGCTGCTGGAGG - Intergenic
1164878087 19:31707077-31707099 TACGAGAGGAATGCTTCTGGGGG - Intergenic
1167633131 19:50638288-50638310 TAGGGTAGGAAAGCAGTTGGAGG + Intronic
925621379 2:5796577-5796599 TAGGGAAGGATTGCTGGAGGTGG + Intergenic
926757703 2:16249550-16249572 AAGACTAGGAATGCTTCTGGGGG + Intergenic
928310180 2:30203312-30203334 TAGGCTGGGAATGCTGCCAGGGG + Intergenic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
928662535 2:33517772-33517794 AAGGGTGAGAATGCTGTTGGTGG - Intronic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930009967 2:46929249-46929271 TAAGGTAGGAAGACTGCTTGAGG + Intronic
930025318 2:47025870-47025892 GAGGGGAGGGATGCTCCTGGAGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932169353 2:69539464-69539486 TAGGGGAGAAATGTGGCTGGTGG - Intronic
936111620 2:109670270-109670292 CAGGTTAGGGATGCTACTGGGGG + Intergenic
936680075 2:114760024-114760046 TAGGGTGGTAATGGTGCAGGTGG - Intronic
947048894 2:226019821-226019843 TATGGGAGGAATGCTGTGGGAGG - Intergenic
947175396 2:227361725-227361747 GGGGGTAGGAATGGGGCTGGAGG + Intergenic
947831328 2:233143913-233143935 CAGGGTAGGAATGGTGAGGGTGG + Intronic
1169243743 20:4008209-4008231 GAGGTTAGGAAACCTGCTGGAGG + Intronic
1169919590 20:10720450-10720472 TAGGTTAGAAAACCTGCTGGAGG - Intergenic
1171032718 20:21691692-21691714 TGGGGCAGGAGTGCAGCTGGTGG + Intergenic
1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG + Intronic
1175701463 20:61140755-61140777 TAGGGGAGGAAGGCTCCAGGTGG + Intergenic
1177947757 21:27492806-27492828 TAGGGTGGGCATTCTGTTGGTGG + Intergenic
1180220262 21:46354174-46354196 CAGGGGAGGAAGGCTGCTTGCGG + Intronic
1180374961 22:12083134-12083156 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
1180738687 22:18037825-18037847 TTGGGTAGGAGAGCTGGTGGCGG + Intergenic
1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG + Intronic
950396444 3:12737634-12737656 TAGGGGTGAAATGCAGCTGGTGG - Intronic
955546902 3:60040785-60040807 TAGGGGAGAAATACTGCTGAGGG + Intronic
956435275 3:69229256-69229278 TAAGGCAGGAAGGTTGCTGGAGG - Intronic
956625184 3:71259884-71259906 GAGGGTGGGGGTGCTGCTGGAGG + Intronic
958079837 3:88732807-88732829 TATGCTAGGCATGCTGCTAGGGG - Intergenic
960871140 3:122251146-122251168 TCTGCTAGGAATGCTGTTGGAGG + Intronic
961479295 3:127169485-127169507 TAGGGGAGAAATGCAGCTAGTGG - Intergenic
966208342 3:177427437-177427459 GAGGGTATGAATCCTGCAGGTGG + Intergenic
966667361 3:182486954-182486976 AGGGATAGGAATGCTGGTGGAGG + Intergenic
975214343 4:71736737-71736759 TAACGTAGAAATCCTGCTGGTGG + Intergenic
975703946 4:77093244-77093266 TAGGGAAGGAAGCCTGATGGTGG + Intergenic
977700690 4:100019502-100019524 TAAGCTAGGAATATTGCTGGAGG - Intergenic
980071137 4:128243694-128243716 TTGGGTAGAAGTCCTGCTGGGGG - Intergenic
1202756548 4_GL000008v2_random:68583-68605 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
985815863 5:2127332-2127354 TAGGGTTGGAATCCTACAGGAGG + Intergenic
985913718 5:2902179-2902201 AAGGGTGAGGATGCTGCTGGAGG + Intergenic
987427385 5:17788937-17788959 TAGAGTAGGAATGATGGAGGTGG + Intergenic
988286406 5:29223920-29223942 TAGGGTAGCAATATTGGTGGTGG - Intergenic
989442242 5:41486534-41486556 TATGGTTGGACTGCTTCTGGAGG + Intronic
993547632 5:89231502-89231524 TAGGTTAGGAATGCTACGGCCGG - Intergenic
993870081 5:93242169-93242191 TGGGGTGGAAATGCTGCTGTAGG + Intergenic
996210022 5:120797750-120797772 CAGGGTAAGGCTGCTGCTGGGGG - Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
998943626 5:147313006-147313028 TAAGGTAGGAAGGCTGCTTGAGG + Intronic
1000184151 5:158842673-158842695 CATGGTAGGTATGCTGATGGTGG + Intronic
1001469193 5:171997204-171997226 GAGGTGAGGAATGCTGCTGCAGG - Intronic
1004739183 6:18440693-18440715 TAGAGTAGGAATGCTTGTTGGGG + Intronic
1006431079 6:33996252-33996274 GGGGGTAGGACTGCGGCTGGGGG + Intergenic
1006956864 6:37881500-37881522 GGAGGTAGGATTGCTGCTGGAGG + Intronic
1007110649 6:39311772-39311794 TCAGGTAGGATTGCTTCTGGTGG + Intronic
1008669152 6:53749076-53749098 GTGGGTATGAATGCTACTGGAGG - Intergenic
1009848152 6:69160460-69160482 TAGGTTAGGAATGCAGTTTGTGG - Intronic
1010147808 6:72692382-72692404 CATGGAAGGAATGCTGCTGCAGG - Intronic
1011022811 6:82833206-82833228 TAGGGAATGGATGCTGCTGATGG + Intergenic
1011406499 6:87020905-87020927 CATGGTAGCAATGCTGATGGGGG - Intergenic
1013368731 6:109453317-109453339 GAAGGTAGCATTGCTGCTGGGGG - Exonic
1016829707 6:148421708-148421730 CAGGGCAAGAGTGCTGCTGGTGG - Intronic
1017642214 6:156505338-156505360 TACGGTAGGAAGGGTCCTGGAGG - Intergenic
1017829378 6:158112017-158112039 TAGGTGAGGAATGCAGGTGGTGG + Intronic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1023037598 7:36147145-36147167 TGGGGAAGGAGTGCAGCTGGTGG - Intergenic
1023556628 7:41430140-41430162 AAGGGAAGGATTGCTGCTGCAGG - Intergenic
1026051786 7:66952923-66952945 CAGGGGAGGAAGCCTGCTGGAGG + Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1029519122 7:101049030-101049052 TAGGGTAAGAAGGTAGCTGGGGG + Intronic
1031375621 7:121021886-121021908 TAGTGTAAGAGTGCTGCTGTTGG + Intronic
1032887848 7:136161723-136161745 TAGTGTGGGTAGGCTGCTGGGGG + Intergenic
1036009606 8:4707424-4707446 TAGTGCAGGAATGCTGATGGTGG + Intronic
1036707066 8:11054068-11054090 TATGGTAGGAATGCTGGGTGGGG + Intronic
1038017243 8:23525635-23525657 TAGGGAAGGCATGCTGCGAGAGG - Intergenic
1038151754 8:24947792-24947814 TAGGGTATGAGTGCTCCAGGTGG - Intergenic
1038265446 8:26036145-26036167 TTGGGTAGGAATGATTCTGAGGG + Intronic
1042786340 8:72550943-72550965 TAGGCTCAGAATGCTGCTGCTGG + Intronic
1043514775 8:80985930-80985952 TGAGGTAGGAATGTTGGTGGCGG - Intronic
1045064457 8:98433377-98433399 TTGGGCATGAATACTGCTGGGGG + Intronic
1050923565 9:11235308-11235330 TAGGGTTGGAATGTTTCTGGTGG + Intergenic
1056414999 9:86367217-86367239 TAAGGTAAGAAAGCTGCAGGGGG - Intergenic
1056810529 9:89760495-89760517 GCGGGTGGGAATGCTGATGGAGG - Intergenic
1057335010 9:94148673-94148695 TACGGTAGGACTGATGCTGATGG + Intergenic
1059149513 9:111936592-111936614 TTAGGTAGGCATGGTGCTGGTGG + Intergenic
1061595854 9:131628649-131628671 TTGGGTGGCAATGCTGGTGGAGG + Exonic
1061756089 9:132813438-132813460 TTGGCTAGGAATCCTCCTGGTGG - Intronic
1203537344 Un_KI270743v1:53440-53462 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
1185978111 X:4744780-4744802 TAAGGAAGGAATGGGGCTGGTGG + Intergenic
1186748709 X:12598552-12598574 CAGGGCACCAATGCTGCTGGTGG + Intronic
1188304092 X:28541257-28541279 TAGGGGAGGAGTGGTGGTGGAGG + Intergenic
1189033527 X:37473253-37473275 TAAGGTAGGAATGCGGGAGGTGG - Intronic
1189572475 X:42313064-42313086 TAGGCTAGGAAGGCTAATGGGGG - Intergenic
1190254618 X:48753342-48753364 TGGGGAAGGAATGATGCTGGAGG - Intergenic
1195883311 X:109615106-109615128 AAGGGCAGGGATGCGGCTGGGGG + Intergenic
1199873090 X:151914604-151914626 GAGGATAGGAGTGCTGGTGGGGG - Intronic
1199873617 X:151916648-151916670 GAGGATAGGAGTGCTGGTGGGGG - Intronic
1200081032 X:153576442-153576464 TGGGATGGGAAGGCTGCTGGTGG + Intronic
1201574451 Y:15447109-15447131 TAGTGTTGAAATGCTGGTGGGGG - Intergenic