ID: 997926711

View in Genome Browser
Species Human (GRCh38)
Location 5:138036826-138036848
Sequence ACCAAAAATGTCTGCACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 3, 2: 29, 3: 82, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997926711_997926712 13 Left 997926711 5:138036826-138036848 CCATGTGTGCAGACATTTTTGGT 0: 1
1: 3
2: 29
3: 82
4: 318
Right 997926712 5:138036862-138036884 TTTTTTTTCCTTCTGAATTCAGG 0: 1
1: 3
2: 18
3: 204
4: 1842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997926711 Original CRISPR ACCAAAAATGTCTGCACACA TGG (reversed) Intronic
900152421 1:1184453-1184475 CCCAGAAATCTCTGCCCACAGGG - Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901040478 1:6360260-6360282 ACCCAAAATGTCTGCCCGGAGGG + Intronic
901140844 1:7028794-7028816 GGCAAAAATCTCTGCACTCATGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901844373 1:11972670-11972692 AACAAAAATGTATGGACAGAGGG - Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
907574140 1:55510712-55510734 AACAGAAATTTCTGCCCACAGGG + Intergenic
907915338 1:58863385-58863407 GTCAAGAATGTCTGAACACATGG + Intergenic
909001930 1:70227822-70227844 AGAAAAAATGTAGGCACACATGG - Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911252848 1:95597854-95597876 AGCAACAATGTGTGCCCACAGGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911721745 1:101198538-101198560 ATCAGAAATGTGTGAACACATGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914320283 1:146552390-146552412 AACAAAAATATTTGCAAACAGGG - Intergenic
915028950 1:152859585-152859607 ACCAATAATCTAAGCACACATGG - Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918718822 1:187826059-187826081 ACCAAACATATCTGCAACCAAGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921523649 1:216189768-216189790 ACAAAAAATGTCTGGACTGAGGG + Intronic
1063161498 10:3421903-3421925 ACGTATGATGTCTGCACACAAGG + Intergenic
1063522624 10:6754743-6754765 ACCAAATATGTGGGCACCCATGG + Intergenic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065382205 10:25101881-25101903 ACCTGAAATGACTGGACACAGGG - Intergenic
1066758521 10:38733701-38733723 ACCACAAAATTCTGCACTCAAGG - Intergenic
1066963132 10:42239057-42239079 ACCACAAAATTCTGCACTCAAGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069316301 10:67107767-67107789 TCCAAACAGGTCTGCACACTGGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070038852 10:72754878-72754900 GCAAAAAATGTCTGCAAACTGGG - Intronic
1070233579 10:74598388-74598410 ACAAAATATGTCTTCTCACAGGG + Intronic
1070665363 10:78338824-78338846 AACAAGAATGACTGGACACAAGG - Intergenic
1070826730 10:79394541-79394563 ACAAAAGGTGCCTGCACACATGG - Intronic
1071019533 10:81035860-81035882 CCCAAAAATGGCTGCACAGATGG - Intergenic
1072231447 10:93417397-93417419 ATCACAAGTGACTGCACACAAGG - Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075817734 10:125278577-125278599 CCCAAATATGTCTGCACAACTGG - Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083265172 11:61543296-61543318 ACCAAGAAAGAGTGCACACAGGG + Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090071294 11:123546778-123546800 ACTACAAATGTCAGCATACAGGG + Intronic
1090324574 11:125873926-125873948 AACAAAGATGTGGGCACACAGGG - Intergenic
1090378280 11:126306885-126306907 ATCAAAAATGTCTTCACCGATGG - Intronic
1092292366 12:7169430-7169452 ACCATAAAAGCCTGTACACAAGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096951318 12:55476731-55476753 ACCACACATATCTGAACACATGG + Intergenic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1100829741 12:98506782-98506804 ACCAAGGATGTGTGCACACAGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1103042710 12:117709151-117709173 CCCAAAGATGTCTGCACCCTTGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106103389 13:26713610-26713632 TCCAGAAATGTCTGGGCACAGGG - Intergenic
1106193951 13:27477318-27477340 ACCACGAACATCTGCACACACGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107657954 13:42611042-42611064 AACAAAAATTGGTGCACACATGG - Intergenic
1107687489 13:42918290-42918312 GCCATAAATGTCAGAACACATGG - Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1113234952 13:108262258-108262280 ACCACACATTTCTGCACTCATGG + Intronic
1113250738 13:108449691-108449713 AAGAAAAATGTCTGCTCTCAAGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1117995621 14:61475015-61475037 ACCCAAAATATCTTCCCACATGG + Intronic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120431611 14:84425038-84425060 CCCAAAAATATCAGGACACATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1123441933 15:20298370-20298392 ACCACAAAATTCTGCACTCAAGG - Intergenic
1125986758 15:44060865-44060887 ATATAAAATGTTTGCACACAGGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130044464 15:80432959-80432981 AGTAAAAATGTTTACACACAAGG - Intronic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130106247 15:80930791-80930813 AGAAAAAATATCTGCCCACAGGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131189487 15:90302214-90302236 AACAAAAATGTCTGCAAAACTGG + Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132627821 16:900333-900355 ACCAAGACAGTTTGCACACAAGG + Intronic
1132874898 16:2132660-2132682 ACCAAAAATGTGAACACACCAGG + Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133718731 16:8474451-8474473 TCCCAAAATGTCTGCACCGACGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134520093 16:14914722-14914744 ACCAAAAATGTGAACACACCAGG - Intronic
1134553840 16:15151510-15151532 ACCAAAAATGTGAACACACCAGG + Intergenic
1134636750 16:15798549-15798571 ATCAAAGATCTCTGCACTCATGG + Intronic
1134707767 16:16313376-16313398 ACCAAAAATGTGAACACACCAGG - Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1134959776 16:18398749-18398771 ACCAAAAATGTGAACACACCAGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136719274 16:32307146-32307168 ACCATAAAATTCTGCACTCAAGG + Intergenic
1136724301 16:32345512-32345534 ACCACAAAATTCTGCACTCAAGG + Intergenic
1136837644 16:33513410-33513432 ACCATAAAATTCTGCACTCAAGG + Intergenic
1136842628 16:33551554-33551576 ACCACAAAATTCTGCACTCAAGG + Intergenic
1137330900 16:47494468-47494490 AACAAAAATGCCTGTAAACATGG + Intronic
1138855107 16:60681350-60681372 GCCAAAAATGTCAGAAAACATGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140013250 16:71157716-71157738 AACAAAAATATTTGCAAACAGGG + Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1203002129 16_KI270728v1_random:172253-172275 ACCACAAAATTCTGCACTCAAGG - Intergenic
1203007157 16_KI270728v1_random:210625-210647 ACCATAAAATTCTGCACTCAAGG - Intergenic
1203133733 16_KI270728v1_random:1708660-1708682 ACCACAAAATTCTGCACTCAAGG - Intergenic
1203147829 16_KI270728v1_random:1813688-1813710 ACCATAAAATTCTGCACTCAAGG + Intergenic
1203152793 16_KI270728v1_random:1851851-1851873 ACCACAAAATTCTGCACTCAAGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145021242 17:19433028-19433050 ACCAAAAATGTCTCCCCAAGTGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1149528018 17:57372958-57372980 ACCAAATATGGCTGGGCACAGGG + Intronic
1149918739 17:60636395-60636417 AACAAAAATTCCTGCACCCATGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153640857 18:7155837-7155859 AACCAACATGTCTGCACTCAGGG + Intergenic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1153962688 18:10152907-10152929 ACATATTATGTCTGCACACATGG - Intergenic
1153970540 18:10222709-10222731 GCCGAAAATGTCTTCACAGATGG - Intergenic
1154135201 18:11771697-11771719 AACAAAAAAATTTGCACACAGGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158296431 18:56002131-56002153 AACACACATGTCTGCACTCAGGG + Intergenic
1158852378 18:61508310-61508332 ACCAAAAACCTCTGCCCTCATGG + Intronic
1158873177 18:61708653-61708675 AGCAAAAATGCCTGAACATATGG - Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161581136 19:5081683-5081705 TCCAGAAATATCTGCACACCGGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162642769 19:12025064-12025086 ACTGAAAATGTCTTCACAGATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164599233 19:29549678-29549700 ACCATATATGTCTCCCCACAGGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1167473430 19:49687537-49687559 ACCACAAATGTTTCCACAGACGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925613651 2:5724887-5724909 ACCACAAATAACTGCACATAAGG - Intergenic
927505510 2:23610950-23610972 AACAAAAATTACTGCCCACATGG + Intronic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
928731281 2:34236209-34236231 ACCAAAATTCTGTGCTCACAGGG + Intergenic
929306668 2:40371165-40371187 ACCTGAAATGAATGCACACAGGG - Intronic
929362776 2:41114182-41114204 ACAAAAAATGTGTGCACTTAAGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
932348669 2:71013829-71013851 ACCACAAAGGTGTTCACACATGG + Intergenic
933119825 2:78522548-78522570 ACCAAAAATTTATTCACACTTGG - Intergenic
935139408 2:100339479-100339501 ACAAAAAAAGCCTGCACACGTGG - Intergenic
935502447 2:103857878-103857900 ACCAAAAATCACTGCAGTCATGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937963707 2:127484544-127484566 ACCAGAAACATCAGCACACAGGG + Intronic
938255358 2:129855168-129855190 ACCAGGGATGTGTGCACACAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941305562 2:163861188-163861210 AGCAAAAATGAATGCTCACATGG - Intergenic
942264664 2:174210517-174210539 ACCAAAACTGTCTACTCATAAGG + Intronic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
943124023 2:183773943-183773965 ACCAATAATCTCTGCTCTCAGGG + Intergenic
943387382 2:187218671-187218693 ACCAAATATCTGGGCACACATGG + Intergenic
945396846 2:209328915-209328937 ACGAAAAATGTCTGAACATTTGG - Intergenic
946638393 2:221756163-221756185 AACAAGCATGTCTGCACCCAGGG + Intergenic
947078146 2:226366388-226366410 ACCAAAAATTCCTGCCCACTGGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169247583 20:4035648-4035670 AACAAAAATCTCTGCCCACTAGG + Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175030670 20:55950643-55950665 ACAAAAAAAGTATGGACACAAGG + Intergenic
1175045244 20:56098937-56098959 ACCCAAAAGTTCTGCACACCTGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175212645 20:57370773-57370795 AACAAAAATCTCTGCTCTCATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175716600 20:61258656-61258678 ACCACCTATGTCTGCACTCACGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1180593820 22:16961189-16961211 CCAAAAAATGACTGCCCACAGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182210868 22:28676469-28676491 ACCACAAAATTCTGCACTCAAGG + Intronic
1182219148 22:28744006-28744028 CCCAAATATGTGTGCACACTGGG + Intronic
1182317802 22:29459550-29459572 CCCAAATATTTATGCACACAGGG + Intergenic
1182480532 22:30606135-30606157 AAAAAAAATCTCTGCAAACAGGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184018238 22:41801696-41801718 AGCAAAAATCTCTGCACTCATGG - Intronic
1184634779 22:45818541-45818563 ACCAAAAAGGACCGCCCACATGG - Intronic
949481336 3:4496270-4496292 AACAAAAACGTCTGCACAACTGG - Intronic
949886234 3:8696812-8696834 ACCACAAAGGTGTTCACACATGG + Intronic
950232506 3:11288720-11288742 ACCAAAAGTTTCTGTCCACATGG - Intronic
950327547 3:12126039-12126061 ACCAAAATTGTTTACACATAAGG + Intronic
950874711 3:16261336-16261358 ACCAAAAATCTCTGCTTCCAAGG + Intronic
951053435 3:18120295-18120317 ACAAAAAATGTTTGCTCTCATGG - Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952564133 3:34634885-34634907 ACCAGAAATGTGTGTGCACAGGG + Intergenic
953329017 3:42036247-42036269 AACAAAAATCTCTGCCCTCATGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953800226 3:46017311-46017333 GACAAAAAGGTCTGCAAACATGG - Exonic
954122287 3:48506406-48506428 ACAGAAAATGCCTGCACACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956172672 3:66444793-66444815 AACAAAAATCTGTGCAAACAGGG + Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
958519612 3:95168178-95168200 ACCAGATATGTATGCACACAGGG + Intergenic
958558922 3:95718038-95718060 ACCAAGAATGTCTGCAATTATGG + Intergenic
958818310 3:98942966-98942988 ACCAAACAAATCTGGACACATGG - Intergenic
959059372 3:101602126-101602148 ACCAAACAAGTCTGAACAAATGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960714982 3:120566231-120566253 AACAAAAATTCCTGCACTCATGG + Intergenic
961374057 3:126450714-126450736 AACAAAAATCTTTGCACACCTGG - Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961865258 3:129949172-129949194 ACCCCAAATGTCTTCCCACAGGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962163813 3:133027722-133027744 ATCAAAAATCTATGCACAAAAGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962829632 3:139128669-139128691 AACACAACTGTCTGCACCCAAGG + Intronic
963548893 3:146696451-146696473 AGCAGAGATTTCTGCACACAGGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
965125551 3:164624448-164624470 ACCAATAATCTCTGAACAGAAGG + Intergenic
965474371 3:169136755-169136777 ACAGAAAAGTTCTGCACACAAGG + Intronic
967176707 3:186867151-186867173 AACAAAAATCTCTGCCCACTAGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969605174 4:8198833-8198855 AGCACAAGTGTGTGCACACATGG - Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
970228426 4:13883703-13883725 ACCAAAAAAGTCTGTAACCAGGG - Intergenic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971779468 4:31013231-31013253 ACCAACTATGGATGCACACATGG + Intronic
974636195 4:64566820-64566842 ACTGAAAATGTCTTCACAGATGG + Intergenic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976102986 4:81585433-81585455 AACACAAATGTATGCACACATGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978074402 4:104511237-104511259 ACAAAAAAGGTGTGTACACAAGG - Intergenic
978314715 4:107422871-107422893 ACCTAAAATTTCTCCACACCAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979866533 4:125762246-125762268 ACAATAAATGAATGCACACAAGG + Intergenic
982225117 4:153157806-153157828 CCCAAAATGGGCTGCACACAAGG + Intronic
982969866 4:161971661-161971683 AGCTTAAATGTCAGCACACAAGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985674233 5:1222051-1222073 ACGATACATATCTGCACACATGG - Exonic
985768217 5:1792779-1792801 TCCCCAAATCTCTGCACACACGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987051394 5:14149309-14149331 AGCAAGACTGTCTGCACAGAAGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987737867 5:21868537-21868559 GAGAATAATGTCTGCACACATGG - Intronic
987777698 5:22390283-22390305 ACAAAAAGTGTCAGCTCACACGG - Intronic
988302984 5:29457012-29457034 ACCAAGAATATCTGCACACTTGG - Intergenic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989780173 5:45255306-45255328 TCCAGAAATGTCTTCACACTTGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991389480 5:66126867-66126889 ACTATAAATGTTTGCATACAGGG - Intergenic
991478308 5:67047636-67047658 AACAAAAATCTCTGCTCTCAAGG - Intronic
991974967 5:72176670-72176692 TCCAAAAATGACTGAATACAAGG - Intronic
992433314 5:76731008-76731030 ACCAAAAATAGGTGAACACATGG - Intronic
992628039 5:78651706-78651728 TGCAAAAATGTCTGCCCTCATGG + Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994896757 5:105715375-105715397 ACAAAAAATCTCAGCACACTAGG + Intergenic
995512745 5:112924458-112924480 AGCAAAAATGTCTACCCTCACGG - Intergenic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002374871 5:178781445-178781467 AGCAAAAATGTTAACACACATGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002545428 5:179940101-179940123 ACCAGGCATGTCTGCACACCTGG + Intronic
1003443802 6:6166765-6166787 ACCAGAAATCTCTGCCCAAATGG - Intronic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1004184262 6:13408456-13408478 AGCAAAAATGTCTGCCTGCAAGG + Intronic
1004602709 6:17165954-17165976 AGAAAAAATGTCTGTACCCATGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007438652 6:41838328-41838350 ACCAAACATATCTGCAACCAAGG + Intronic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009014369 6:57880699-57880721 ACCCAAAATGTATACACAGAAGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010508137 6:76685841-76685863 ACAAAAAATGTGTGCATTCAAGG - Intergenic
1011878131 6:91988353-91988375 GACAAAAATCTCTGCCCACATGG + Intergenic
1012173571 6:96050011-96050033 ACCAGAATTCTCTGCTCACAAGG + Intronic
1012310246 6:97714988-97715010 ACCAGAGCTGTGTGCACACAGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1013880041 6:114886814-114886836 ACAAAATATGTCTGGACCCATGG - Intergenic
1016176945 6:141090767-141090789 ACAAAAAATTTATGCAAACAAGG - Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1018723634 6:166592894-166592916 ACCAAAAACATCAGCACAAAAGG + Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020448689 7:8297663-8297685 ACCCAAACTATCCGCACACATGG + Intergenic
1021125394 7:16846321-16846343 ACCAAAAATCTCAGCAACCACGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025853798 7:65261806-65261828 AACAAAAATCTCTGCCCACTAGG + Intergenic
1026052314 7:66957817-66957839 GCCAAAAATGCCTGGACAGATGG + Exonic
1027657905 7:80954151-80954173 ACCAAAAATGTATTCGTACAGGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029079723 7:97962957-97962979 ACCACAAAGGTGTTCACACATGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032270994 7:130405528-130405550 ACCAAAAAGGTCTGTAAGCATGG - Intronic
1036172448 8:6501854-6501876 ACCAAAAATTTGAGAACACAGGG - Exonic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037881560 8:22575785-22575807 ATCAAAACAGTCTGCAAACAAGG - Exonic
1038068693 8:23989856-23989878 GCCAAAAAACTTTGCACACATGG - Intergenic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1039794640 8:40902425-40902447 AGAATAAAGGTCTGCACACATGG + Intergenic
1040562885 8:48540359-48540381 ACCAAAAAGGGCTGCAAACCAGG - Intergenic
1040994836 8:53391044-53391066 ACCAAAAATATCTGCATCCTAGG - Intergenic
1042056859 8:64773152-64773174 ACAAAAAATATCTGCACTTATGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046758425 8:117995276-117995298 AACAAAGATGCCTGAACACATGG - Intronic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047872611 8:129101578-129101600 ACCAAAAATGTGTGGAAACCTGG - Intergenic
1049396742 8:142404444-142404466 GGCACAAATGTGTGCACACATGG + Intergenic
1049569445 8:143361982-143362004 TCCAAAAATGTCTGACAACAAGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050797544 9:9562903-9562925 GGCAAAGATGTCTGCCCACATGG - Intronic
1052424574 9:28288023-28288045 ACCACACATTTCTGCACTCATGG + Intronic
1052838760 9:33272887-33272909 TCCACAAATGTTTGCATACATGG + Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056279126 9:85022652-85022674 AGCAGTAGTGTCTGCACACAAGG - Exonic
1059821641 9:117980152-117980174 GCACAAAATGTGTGCACACAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061868096 9:133505804-133505826 ACCAAAGATGTCAGCACAGAAGG - Intergenic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186868484 X:13745646-13745668 ACCCAAAAAGTATGCACAGAGGG - Intronic
1187247485 X:17565938-17565960 ACCAAGAATTTCTTCACAAATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187779466 X:22802448-22802470 AACAAAACTGTCTGCAAACTAGG - Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189044455 X:37575369-37575391 ACCAAAAATGTCTACCCTTATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1193652490 X:84155025-84155047 AAAAAAAATTTCTGGACACAAGG - Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195645690 X:107228578-107228600 ACCAAAAATGCCTCCACCTAGGG - Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196020846 X:110989363-110989385 AAAAAAAATATCTGGACACATGG - Intronic
1196048451 X:111280552-111280574 ACCAAAGATTTCTACATACATGG + Intergenic
1196688607 X:118534688-118534710 AGCTAAAATGGCAGCACACAAGG - Intronic
1197246597 X:124173079-124173101 ACCAAAAATGTCATAACACGTGG - Intronic
1198334102 X:135650579-135650601 GCCATAAAGGCCTGCACACAGGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201772834 Y:17633809-17633831 AACAAAAATATCAGCACATATGG - Intergenic
1201828721 Y:18272177-18272199 AACAAAAATATCAGCACATATGG + Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic