ID: 997930035

View in Genome Browser
Species Human (GRCh38)
Location 5:138065218-138065240
Sequence GTCCGCATGCTGCTGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997930035_997930039 7 Left 997930035 5:138065218-138065240 CCAGCTACCAGCAGCATGCGGAC No data
Right 997930039 5:138065248-138065270 CCCAGCTCCCTCATCTCAACTGG No data
997930035_997930044 23 Left 997930035 5:138065218-138065240 CCAGCTACCAGCAGCATGCGGAC No data
Right 997930044 5:138065264-138065286 CAACTGGCAACAACTCTGAAGGG No data
997930035_997930043 22 Left 997930035 5:138065218-138065240 CCAGCTACCAGCAGCATGCGGAC No data
Right 997930043 5:138065263-138065285 TCAACTGGCAACAACTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997930035 Original CRISPR GTCCGCATGCTGCTGGTAGC TGG (reversed) Intergenic
No off target data available for this crispr