ID: 997931949

View in Genome Browser
Species Human (GRCh38)
Location 5:138080024-138080046
Sequence ATGTATAAGATAATTCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997931946_997931949 20 Left 997931946 5:138079981-138080003 CCATCTTAAAGGCTCATCTAATC No data
Right 997931949 5:138080024-138080046 ATGTATAAGATAATTCTGGCCGG No data
997931945_997931949 28 Left 997931945 5:138079973-138079995 CCAGGTATCCATCTTAAAGGCTC No data
Right 997931949 5:138080024-138080046 ATGTATAAGATAATTCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997931949 Original CRISPR ATGTATAAGATAATTCTGGC CGG Intergenic
No off target data available for this crispr