ID: 997932150

View in Genome Browser
Species Human (GRCh38)
Location 5:138081644-138081666
Sequence CCTCTCTGCTTGGGGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997932150_997932164 18 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932164 5:138081685-138081707 AAGAGAGCTTGCGGGGGGCTGGG No data
997932150_997932162 13 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932162 5:138081680-138081702 AAAGGAAGAGAGCTTGCGGGGGG No data
997932150_997932163 17 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932163 5:138081684-138081706 GAAGAGAGCTTGCGGGGGGCTGG No data
997932150_997932158 9 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932158 5:138081676-138081698 AATCAAAGGAAGAGAGCTTGCGG No data
997932150_997932165 21 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932165 5:138081688-138081710 AGAGCTTGCGGGGGGCTGGGAGG No data
997932150_997932160 11 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932160 5:138081678-138081700 TCAAAGGAAGAGAGCTTGCGGGG No data
997932150_997932155 -5 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932155 5:138081662-138081684 AGAGGCCCACAAGCAATCAAAGG No data
997932150_997932159 10 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932159 5:138081677-138081699 ATCAAAGGAAGAGAGCTTGCGGG No data
997932150_997932161 12 Left 997932150 5:138081644-138081666 CCTATTTTCCCCAAGCAGAGAGG No data
Right 997932161 5:138081679-138081701 CAAAGGAAGAGAGCTTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997932150 Original CRISPR CCTCTCTGCTTGGGGAAAAT AGG (reversed) Intergenic
No off target data available for this crispr