ID: 997932793

View in Genome Browser
Species Human (GRCh38)
Location 5:138086032-138086054
Sequence GGACCTTTGCTGCTTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997932793_997932794 -7 Left 997932793 5:138086032-138086054 CCAGTCAGAAGCAGCAAAGGTCC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 997932794 5:138086048-138086070 AAGGTCCTCCTCTCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997932793 Original CRISPR GGACCTTTGCTGCTTCTGAC TGG (reversed) Intronic
900103958 1:974343-974365 GAACCCTGGCTGCCTCTGACAGG + Exonic
903379679 1:22887839-22887861 CAACCTTTGCTCCTTCTGCCTGG - Intronic
904131998 1:28282055-28282077 GGTCCTTGGCTGCTTCTGCCTGG - Exonic
905540547 1:38756926-38756948 GTAGCTTTGCTGCTTCTGAGTGG + Intergenic
908335822 1:63122169-63122191 GTATGTTTGCTGCTTCTAACGGG - Intergenic
911463322 1:98218289-98218311 GGAGCATTGCTGCTTTTGATGGG - Intergenic
917417262 1:174823520-174823542 GAACCCTTGTTGCTTCTCACTGG + Intronic
1062959523 10:1562121-1562143 GGACCCTTGGTTCTTCTGCCTGG + Intronic
1066316459 10:34252241-34252263 GGACCTCAGCTGCCTCTGAGGGG - Intronic
1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG + Intronic
1070674680 10:78404367-78404389 GAAGCTTTGCAGCTTCTGCCCGG + Intergenic
1071744500 10:88400784-88400806 GGACTTTTGCTGCTTATGGGAGG + Intronic
1071783598 10:88875070-88875092 GGACCTTTCCTGCCTCTGACTGG - Intergenic
1074772830 10:116744421-116744443 GGGTTTCTGCTGCTTCTGACAGG - Intergenic
1074775246 10:116763227-116763249 GGAAACTTGCTGCTTCTGAATGG + Intergenic
1074948961 10:118309617-118309639 GTACATTTCCTGGTTCTGACAGG - Exonic
1075229125 10:120657550-120657572 GGGCCTTGGCTGCTTATGAGAGG + Intergenic
1076610481 10:131723050-131723072 GGAGCTTTTCTGCTTCTCTCTGG - Intergenic
1076930738 10:133530078-133530100 GGGACTTTGCTGCCTCTGCCTGG + Intronic
1078517632 11:12037464-12037486 GGTCCTGGGCTGCTTCTGTCTGG - Intergenic
1078839941 11:15069116-15069138 GAACCTTTGCTGGTTTTAACAGG + Intronic
1081604979 11:44521511-44521533 GGACTTTTGATCCTTCTCACTGG + Intergenic
1082125901 11:48430567-48430589 GGACCTCAGCTGCTTCTAATCGG + Intergenic
1084916476 11:72432722-72432744 GGACTTTTGCTTCTCCTCACGGG - Intronic
1085767389 11:79295062-79295084 GTACCTCTGCTGCTTCTCAGAGG - Intronic
1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG + Intronic
1091775422 12:3181837-3181859 GCTCCTTTGCTGTATCTGACAGG + Intronic
1095719043 12:45380498-45380520 AGACCTGTGCTGCTTCTGCTAGG + Intronic
1100016233 12:90014026-90014048 TGTCCATTTCTGCTTCTGACAGG - Intergenic
1100953092 12:99874701-99874723 GGACATATGCTGCTCCAGACAGG + Intronic
1103162637 12:118742758-118742780 GGACTATTTCTGCTGCTGACTGG - Intergenic
1103299559 12:119917767-119917789 GAAACTTTGCAGCTTCTGCCTGG - Intergenic
1103420488 12:120777853-120777875 TCACCTTTGCTGATTCTGACAGG - Intronic
1104529224 12:129553297-129553319 GCACCTGTGCTGCTGCTGTCAGG + Intronic
1105426868 13:20301880-20301902 GGCCCTTTGCAGCGTCTGAGCGG - Intergenic
1105921299 13:24966189-24966211 AGACCTGTGCTGCTTCTAACTGG - Intergenic
1108626481 13:52233743-52233765 AGGCCTGTGCTGCTTCTAACTGG - Intergenic
1108659586 13:52572745-52572767 AGGCCTGTGCTGCTTCTAACTGG + Intergenic
1111259922 13:85724305-85724327 GGACCATAGCTGCTTCTAATCGG - Intergenic
1114567585 14:23644002-23644024 GGACCTGTGTTGCTTCTGTGAGG + Intronic
1116394310 14:44429828-44429850 GGTCCTTTGCTGATTCCAACTGG + Intergenic
1117337684 14:54768580-54768602 GGATCATTTCTGCTTTTGACTGG - Intronic
1117540719 14:56744141-56744163 AGATCTTTGCTGATACTGACAGG + Intergenic
1119078847 14:71673060-71673082 GGACCTTTGCTGTCTCAGTCTGG + Intronic
1123615120 15:22138145-22138167 GGACCTTCCCTGCTTATGACTGG + Intergenic
1124387926 15:29225305-29225327 GGACTTCTCCTGCTTCTGAGAGG - Intronic
1124421217 15:29524657-29524679 CGCCCATTGCTGCTTCCGACTGG - Intronic
1124439072 15:29674208-29674230 GAGCGTTTGCTGCTTCTGGCTGG - Intergenic
1126986713 15:54319908-54319930 GGACCCTTGATGCTTCTGATGGG + Intronic
1128288641 15:66459891-66459913 GGAACTATGCTGCCTCTGCCAGG + Intronic
1129293196 15:74584444-74584466 GGACCCTTGCTGCTTTTTCCAGG - Intronic
1129329304 15:74818823-74818845 TCACCCTTCCTGCTTCTGACAGG + Intronic
1129824365 15:78625066-78625088 GGCACTTTGCTGCTTCTTTCTGG - Exonic
1132365798 15:101255646-101255668 TGCCCTTTCCTGCATCTGACTGG - Intergenic
1134213617 16:12298719-12298741 GGACCCTTGCTGTCTCTCACCGG + Intronic
1135524749 16:23205801-23205823 GGACTGCTGCTGCTTCTGCCAGG - Intronic
1135918354 16:26625967-26625989 GGAACTTTGCTGCCCCTGACTGG - Intergenic
1136065792 16:27757446-27757468 GGACAGTGGCTGCTTCTGCCTGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142929483 17:3270690-3270712 GATCCTTTTATGCTTCTGACGGG + Intergenic
1144761839 17:17711459-17711481 GGCCCTTGGCTGCCTCTGAAAGG - Intronic
1145259024 17:21343802-21343824 GGACCTCTGCAGCCTCTGGCTGG - Intergenic
1145317594 17:21744201-21744223 GGACCTCTGCAGCCTCTGGCTGG + Intergenic
1151370023 17:73642070-73642092 AGACTTTCTCTGCTTCTGACAGG + Intronic
1151620763 17:75243477-75243499 TGATCTTTGCTTCTTCTGGCAGG + Exonic
1151748267 17:76023025-76023047 GAACCTTTGCTCCTTCTTTCTGG + Intronic
1151971741 17:77460866-77460888 AGACCCTTCCGGCTTCTGACTGG + Intronic
1153168272 18:2286317-2286339 GGAATATTGCTGCTTCTTACTGG - Intergenic
1153483771 18:5574776-5574798 GGACCTTGGCAGCTTGTGCCTGG + Intronic
1157484666 18:48078391-48078413 GGACCTCTGCTGCCTCTGGGGGG + Intronic
1158015827 18:52782666-52782688 GGACCTTTCATGCTTGTGACTGG + Intronic
1159173948 18:64810667-64810689 GAATCTTTGCTATTTCTGACTGG - Intergenic
1160004861 18:75062147-75062169 GGGCCCTCGCTGCTTCTGTCTGG + Intronic
1160032509 18:75275063-75275085 GCACCTGTGCTGCTACTGATGGG - Intronic
1164513800 19:28917642-28917664 GGACCTCAGCTGCCCCTGACTGG + Intergenic
925753102 2:7107603-7107625 GCACCTTGGCTGCTTCAGAATGG - Intergenic
927338765 2:21955727-21955749 GGACTTTTGTGGCTTTTGACAGG + Intergenic
928391000 2:30910873-30910895 TGGCCCTTGCTGCTTCTGGCAGG + Exonic
930543280 2:52734675-52734697 GAACCCCTGCTGCCTCTGACAGG - Intergenic
932690998 2:73913654-73913676 GCCCCTTTTCTGATTCTGACTGG + Intronic
933200056 2:79437895-79437917 GGGTCTTTTCTGTTTCTGACAGG + Intronic
933985360 2:87586601-87586623 GAAACTTTGCAGCTTCTGCCTGG - Intergenic
936308481 2:111364208-111364230 GAAACTTTGCAGCTTCTGCCTGG + Intergenic
937289699 2:120774837-120774859 AGACCTTTGCTTCCTCTGAGGGG + Intronic
939134070 2:138273423-138273445 CGCCCATTGCTGCTCCTGACTGG - Intergenic
943553790 2:189375475-189375497 GGACAATGGCTGCTTCTGTCAGG + Intergenic
944279207 2:197875394-197875416 GGACATTTGTTGCTTTTGAAAGG + Intronic
946786268 2:223247013-223247035 GGACCACAGCTGCTTCTAACTGG + Intergenic
1170244368 20:14204457-14204479 GTACCATAGCTGCTTCTGTCTGG + Intronic
1171114719 20:22515428-22515450 GGGCCTTTGCTCCTTCTCCCAGG - Intergenic
1172865565 20:38094486-38094508 GGACCTCAGCTGCTTCTTACAGG + Intronic
1176031677 20:63015932-63015954 GGACCTGTGATGCGGCTGACTGG - Intergenic
953636867 3:44671440-44671462 GGACCTGTTCTGCTTCTGACTGG + Intergenic
954364813 3:50140123-50140145 GGGCCTTTGCTGCCTCTGTGAGG - Intergenic
954583920 3:51718424-51718446 GCACCTTTGCTGGTTAGGACTGG - Intronic
963954182 3:151234916-151234938 GAACGTTTGCTGCTTCAGGCTGG - Intronic
964136310 3:153348635-153348657 AGACCTTAGATCCTTCTGACAGG + Intergenic
968710052 4:2107998-2108020 GCACCTTTGCTCCTTTTGCCTGG + Intronic
969453858 4:7290041-7290063 AGACCTTTGCTGCCTCTGAGTGG + Intronic
972008062 4:34136929-34136951 TCACCTTTGTTGCTTCTGATTGG + Intergenic
974919463 4:68220428-68220450 GGAGCTTTGCTTTTTTTGACCGG - Intergenic
984465773 4:180099282-180099304 GGACCTGGGCTGCTTCTGGTTGG + Intergenic
984985948 4:185329625-185329647 GGCCCTTTGCTGATTCCAACTGG - Intronic
985599695 5:820633-820655 GGACCTTTGCTGCCTCTCTGTGG + Intronic
987226442 5:15846632-15846654 GGTTGTTGGCTGCTTCTGACTGG + Intronic
988904913 5:35776882-35776904 AGACCTTTGTTGCTACTGAGGGG + Intronic
989765407 5:45076764-45076786 GAATCTCTGCTGCTGCTGACAGG + Intergenic
991985887 5:72286772-72286794 GAACCTTTGCTGCTACTGCTGGG + Intronic
992084546 5:73266383-73266405 TGACCTCTGCTGCTGCTGCCTGG + Intergenic
993864702 5:93178396-93178418 GGAACTGTGCTGCTTCTGTATGG - Intergenic
994616461 5:102110542-102110564 GGACCATAGCTGCTTCTAATCGG - Intergenic
996778886 5:127161195-127161217 GGACCTCAGCTGCTTCTAATCGG + Intergenic
997932793 5:138086032-138086054 GGACCTTTGCTGCTTCTGACTGG - Intronic
1001130760 5:169061624-169061646 GGACCTTCCCTGCATCTAACTGG - Intronic
1001281765 5:170391161-170391183 GGACTTTTCCTGCTTCTGAGTGG - Intronic
1005654742 6:27923826-27923848 GGAAATTTGCTGATTCTGAGGGG + Intergenic
1014499469 6:122167277-122167299 GGAACGTGGCTGCTTGTGACTGG + Intergenic
1022469556 7:30673954-30673976 GGCCCTTTGCTGGTGCTGTCTGG + Intronic
1023787594 7:43723446-43723468 TGACTATTGCTGCTTCTGACAGG - Intronic
1026877321 7:73887078-73887100 GGACATTTTCTGCTTCTCATGGG + Intergenic
1035435474 7:158856406-158856428 GGTCCTCTGCTGCTCCTGCCTGG + Intergenic
1038417926 8:27410999-27411021 AGACCTTTGCTTCTTCCCACAGG - Intronic
1047191187 8:122680676-122680698 GAAATTTTGCTGCTTCTGGCAGG + Intergenic
1048769338 8:137878993-137879015 GCACCTTTGCTAATTCTGGCTGG - Intergenic
1049042593 8:140123987-140124009 GGACACTTGCTGCTTCAGCCAGG - Intronic
1049053948 8:140220349-140220371 GGGCCTTTGCTGCCTCTGCTGGG + Intronic
1049691916 8:143965242-143965264 GGACTGTTGCTGCTTCTTCCTGG - Intronic
1049985588 9:947965-947987 GAGCCCTTGCTGCTGCTGACTGG + Intronic
1050396519 9:5203854-5203876 GGACCATTGTGGCATCTGACAGG - Intergenic
1052551040 9:29949477-29949499 GGTCCTTGGCTGTTTCTGGCTGG + Intergenic
1054735065 9:68742747-68742769 GGATCTTTGCTGTTTCTGAGTGG + Intronic
1054903448 9:70393267-70393289 GGACACTTGCTGCTTTTGAGAGG + Intronic
1059325535 9:113501967-113501989 TAACTTTTCCTGCTTCTGACAGG + Intronic
1060483698 9:124033655-124033677 GGCCCTTTTCTGCTCCTGGCTGG + Intergenic
1187645980 X:21348018-21348040 GGACCACAGCTGCTTCTAACTGG - Intergenic
1190072871 X:47293199-47293221 GGCCCTTTGCTGATTCCAACTGG - Intergenic
1192148808 X:68699179-68699201 GGCCCTTGGCTGCTTCCCACAGG - Intronic
1192177254 X:68893890-68893912 GGACTTTGCCAGCTTCTGACAGG - Intergenic
1194264117 X:91734274-91734296 GGACCTCAGCTGCTTCTAATTGG + Intergenic
1195672917 X:107484280-107484302 GGCCCAGTGCTGGTTCTGACCGG - Intergenic
1199945188 X:152659630-152659652 GCCCCTTTGCTATTTCTGACAGG + Intergenic
1200546741 Y:4527288-4527310 CGCCCATTGCTGCTTCTGATTGG - Intergenic