ID: 997952819

View in Genome Browser
Species Human (GRCh38)
Location 5:138255535-138255557
Sequence TAGTACCATTGCCAGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997952819 Original CRISPR TAGTACCATTGCCAGATCAA AGG (reversed) Intronic
907607270 1:55830485-55830507 TGGTACCATTCAGAGATCAAGGG - Intergenic
907709728 1:56868206-56868228 TAGTACCATTGACATATGAAGGG + Intronic
908236214 1:62149662-62149684 TATTTCCATAGCCACATCAAAGG - Intronic
909525407 1:76616555-76616577 TAATACCTTTGCCAAATAAAAGG - Intronic
909716607 1:78715477-78715499 CATTACCATTTCCATATCAATGG + Intergenic
910266688 1:85345504-85345526 TAGTACCTTTGCCATATGGATGG + Intronic
910561338 1:88595371-88595393 TAGTAGAATTTCAAGATCAATGG + Intergenic
916532876 1:165674843-165674865 TAACCCCATTGCCAGATGAACGG + Intronic
918974475 1:191464305-191464327 TAGTTCCATTGCAAGAGGAATGG - Intergenic
919472823 1:198000013-198000035 TAGTCCCAATGGCAGATCATGGG - Intergenic
923240955 1:232085061-232085083 TAGCACCATGGACAGATCACAGG - Intergenic
923581838 1:235224746-235224768 TAGAACCATTTCCAGAAGAAAGG - Exonic
923870117 1:237983172-237983194 TATTAACACTGCTAGATCAAGGG - Intergenic
1064441319 10:15356426-15356448 GAGTGCCATTGCTAGATCATAGG - Intronic
1064610140 10:17090444-17090466 TAGTTCCAAAGCCAAATCAATGG - Intronic
1068043037 10:51850954-51850976 AAGTAGGATTGCTAGATCAAAGG - Intronic
1070375183 10:75823594-75823616 TAGTGGGATTGCAAGATCAAAGG - Intronic
1071489932 10:86129329-86129351 TGTTGCCATTGACAGATCAAGGG - Intronic
1080096829 11:28418318-28418340 TAGCACCTTTGCCTGATCAGTGG + Intergenic
1081583616 11:44369392-44369414 TGGTCCCATTGCCAGTTCCAAGG - Intergenic
1090300918 11:125638649-125638671 CTGTACCATGTCCAGATCAAAGG - Intronic
1092596810 12:10015272-10015294 TGGTACCATTGCCACATCTTAGG - Exonic
1094743974 12:33321734-33321756 TAGTACCAATGCCATCTCATAGG - Intergenic
1096010746 12:48212416-48212438 TATTACCATTACCAGATGACTGG - Intergenic
1098018764 12:66133846-66133868 TAATACCATTTTCAGTTCAAAGG - Intronic
1098742060 12:74185108-74185130 TAGCACCAGTGCCCGATGAATGG - Intergenic
1101653763 12:106701632-106701654 TAGTAGCATTGGCATAGCAAAGG - Intronic
1104298110 12:127537349-127537371 TACTACGATTGCCAGATAACAGG + Intergenic
1105429204 13:20321815-20321837 TCGTAACATTGCCAGAACAAGGG + Intergenic
1105524199 13:21160702-21160724 GAGTAGAATTGCCAGGTCAAAGG - Intronic
1106541651 13:30696092-30696114 TAGAACCATTGTCAGAGAAATGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112099445 13:96170878-96170900 AAGTAGGAATGCCAGATCAAGGG + Intronic
1113087294 13:106581533-106581555 TAGGACCAGGGCCAGATCCAGGG - Intergenic
1113605788 13:111604351-111604373 CAGTCCCATTGCCCGAACAAAGG - Intronic
1117190572 14:53286516-53286538 TATTAAAATTGCCAGCTCAAGGG + Intergenic
1118075796 14:62297392-62297414 AAGTACCAGTGACAGATCGACGG - Intergenic
1118828092 14:69402639-69402661 AAGTACAGTTGCCAGGTCAAAGG - Intronic
1120669410 14:87347019-87347041 AAGTTCCATGGCCAAATCAAAGG - Intergenic
1122596546 14:102897412-102897434 TAGGACTACGGCCAGATCAAAGG + Intronic
1123853525 15:24383890-24383912 AAGTGCCATGGCCAGAGCAAGGG - Intergenic
1128545977 15:68568083-68568105 TGGCCCCATTGCCAGATCACTGG - Intergenic
1130850030 15:87783834-87783856 TAGAACCATTGACACATAAAAGG - Intergenic
1131315815 15:91336157-91336179 GAGTATCGTTGCCATATCAAAGG - Intergenic
1131494627 15:92895200-92895222 GAGTACCATTCCCACAGCAAAGG - Intronic
1131827395 15:96332098-96332120 GACTACCATTGCCATATCTATGG - Exonic
1134403612 16:13935620-13935642 TAGTACCCTTGTCAGAGCATAGG - Exonic
1137852931 16:51764254-51764276 TAGTGGCATTTCCAGATGAATGG - Intergenic
1146958020 17:36948375-36948397 AAGTACCCTTGCCTGAGCAAGGG - Intergenic
1148229576 17:45923298-45923320 TAGACCCATTTCCAGAACAAGGG + Intronic
1149525915 17:57355670-57355692 AAATAGCATTGCCAGAACAAGGG - Intronic
1150895957 17:69211101-69211123 TAGTAGGATTGCTGGATCAAAGG - Intronic
1157678976 18:49588843-49588865 TAGTACCCTTGTTAGAGCAAAGG - Intronic
1162753556 19:12843562-12843584 TGGTGCCATAGCCAGATGAAGGG - Exonic
927402589 2:22730751-22730773 TCATACCATTTCCAGATAAAGGG + Intergenic
928059333 2:28095099-28095121 TGGTAGGATTGCCAGGTCAACGG + Intronic
929179346 2:39017997-39018019 TTTTACCATTGCCTAATCAATGG - Intronic
929813271 2:45209916-45209938 TTGTAACATTGCAAGAGCAAAGG - Intergenic
929973032 2:46600327-46600349 GAGTAACATTCCTAGATCAAAGG - Intronic
930944038 2:57049619-57049641 TAGTAAGATTGCTGGATCAATGG + Intergenic
931521369 2:63100738-63100760 TAGTGGGATTGCCAGATCATAGG + Intergenic
939408100 2:141786078-141786100 TACTTTCATTGCCAGATGAAAGG - Intronic
941947594 2:171116910-171116932 GAGTACAATTGCTAGATCATAGG - Intronic
942266307 2:174229343-174229365 GAGTACCTGTGCCAGATGAAAGG - Exonic
942938594 2:181589427-181589449 TAATATTATTGCCAGACCAATGG + Intronic
948381381 2:237552114-237552136 TAATGCCAGTGCCAGAGCAAAGG + Intronic
1168968813 20:1916833-1916855 AAGTGCCATTGCTAGATCAGAGG + Intronic
1170369598 20:15634637-15634659 TAGTACCATTGCCACAGCCATGG - Intronic
1173540455 20:43847256-43847278 TAGTAGGATTGCTAGATCAAAGG + Intergenic
1175292558 20:57886592-57886614 TAGTGGGATTGCTAGATCAAAGG + Intergenic
1184064354 22:42108744-42108766 GAGTACCTGTGCCAGATGAAAGG - Intergenic
949218357 3:1599884-1599906 TGGTTCAATTGCCAGACCAATGG + Intergenic
952985661 3:38779062-38779084 AAGTAGAATTGCCAGGTCAAAGG - Intronic
953140119 3:40221762-40221784 AAGTACAATTGCCAGATCAAAGG - Intronic
953196170 3:40735684-40735706 TATTACCATAGTCAGATCACGGG - Intergenic
954141125 3:48606253-48606275 TAAAATCATTGCCAGAACAAAGG - Intronic
955004877 3:54959111-54959133 TAATAGGATTGCCAGATAAAGGG - Intronic
959692537 3:109214098-109214120 TAGTAGAATTGCAAGATCAATGG + Intergenic
959827528 3:110816418-110816440 ATGTTCCATTGCCAGCTCAATGG - Intergenic
963611032 3:147468525-147468547 TAAAACCATTGCCAAATCTAAGG + Intronic
965513586 3:169596361-169596383 TATTACGTTTGCCCGATCAAGGG - Intronic
965744509 3:171910138-171910160 AAGAAACATTGCCTGATCAAAGG + Intronic
976719279 4:88154415-88154437 TAGTCCCTTTGCAAGAGCAAGGG + Intronic
977151321 4:93516354-93516376 TAGTAGCAGTGGCAGATAAAGGG - Intronic
979140064 4:117161841-117161863 TATTTCCATTGCCAAATCCAAGG - Intergenic
981264107 4:142760767-142760789 TAGCACCATTGCTAGGCCAAAGG - Intronic
982490452 4:156023227-156023249 TAGGACCACTGCCTGATCCAGGG - Intergenic
984467087 4:180113511-180113533 TAGTGCCATTGACAGGTTAATGG - Intergenic
987171356 5:15261749-15261771 TAGGAGCATTGCCAGTTAAAGGG + Intergenic
987429642 5:17816761-17816783 TAGTTCCATTTCTATATCAAAGG + Intergenic
987749147 5:22017347-22017369 TAGTAGCAATTCCAGATAAAGGG + Intronic
991556979 5:67906491-67906513 AAGTGCCATTGACAGATGAATGG + Intergenic
992722184 5:79571290-79571312 TAGTCCCATTCCCATTTCAAAGG + Intergenic
993393677 5:87355386-87355408 TAGTTCCATTGACAGAGCACAGG - Intronic
997952819 5:138255535-138255557 TAGTACCATTGCCAGATCAAAGG - Intronic
1000962800 5:167620174-167620196 ATGTACCATTGTCAGATCTAAGG - Intronic
1003724035 6:8738769-8738791 AAGGACCATTGCCAAATCCAAGG - Intergenic
1006978795 6:38128862-38128884 TAGTGGGATTGCCGGATCAATGG + Intronic
1013565761 6:111359965-111359987 GAGTAGGATTGCCACATCAATGG - Intronic
1017781411 6:157718300-157718322 TAGTAGGATTGCCAGATCCAAGG + Intronic
1018495876 6:164344995-164345017 TAGTACCATTTACATTTCAATGG - Intergenic
1023266379 7:38410459-38410481 TAATGCCATGGCCAGTTCAAAGG - Intronic
1026366861 7:69656945-69656967 TAGTCCTTTTGCCAGATGAATGG + Intronic
1028434709 7:90789048-90789070 AAGTGCCATTGCAAGGTCAAAGG - Intronic
1032185703 7:129723626-129723648 TAGTAGTAATTCCAGATCAAGGG + Intronic
1040076007 8:43231567-43231589 TTGTTCCATTTCCAGAGCAAAGG + Intergenic
1043808811 8:84708389-84708411 TAGTACAATTGCTAGGTAAAAGG + Intronic
1044564658 8:93649825-93649847 GAGCACCCTTGGCAGATCAAAGG + Intergenic
1053279869 9:36813191-36813213 TATTACAATTGGCAGAGCAATGG - Intergenic
1060611493 9:124969762-124969784 TAGTAGAATTGCAAGATCAGAGG - Intronic
1186061821 X:5716910-5716932 TAATTCAATTGCCAGATTAAAGG - Intergenic
1192551307 X:72056200-72056222 GAGTAGAATTGCCACATCAAAGG - Intergenic
1192944629 X:75951941-75951963 TAGTGGAATTGCTAGATCAAAGG + Intergenic
1194547256 X:95252548-95252570 TAGTAGGATTGCTGGATCAAAGG + Intergenic
1194915817 X:99707386-99707408 TAGTTCCTTTGCCTGATCACTGG - Intergenic
1198225754 X:134644406-134644428 TGGTACCATTGACAGAAAAATGG - Intronic