ID: 997953094

View in Genome Browser
Species Human (GRCh38)
Location 5:138257676-138257698
Sequence GCCTGTGGCCCCCAACTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997953094_997953100 -4 Left 997953094 5:138257676-138257698 CCAGGCAGTTGGGGGCCACAGGC 0: 1
1: 0
2: 1
3: 36
4: 330
Right 997953100 5:138257695-138257717 AGGCGGCAGCGCGCAGTTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
997953094_997953097 -7 Left 997953094 5:138257676-138257698 CCAGGCAGTTGGGGGCCACAGGC 0: 1
1: 0
2: 1
3: 36
4: 330
Right 997953097 5:138257692-138257714 CACAGGCGGCAGCGCGCAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 101
997953094_997953101 2 Left 997953094 5:138257676-138257698 CCAGGCAGTTGGGGGCCACAGGC 0: 1
1: 0
2: 1
3: 36
4: 330
Right 997953101 5:138257701-138257723 CAGCGCGCAGTTGGGGGCGATGG 0: 1
1: 0
2: 0
3: 7
4: 77
997953094_997953099 -5 Left 997953094 5:138257676-138257698 CCAGGCAGTTGGGGGCCACAGGC 0: 1
1: 0
2: 1
3: 36
4: 330
Right 997953099 5:138257694-138257716 CAGGCGGCAGCGCGCAGTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 82
997953094_997953102 13 Left 997953094 5:138257676-138257698 CCAGGCAGTTGGGGGCCACAGGC 0: 1
1: 0
2: 1
3: 36
4: 330
Right 997953102 5:138257712-138257734 TGGGGGCGATGGTGTTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 109
997953094_997953098 -6 Left 997953094 5:138257676-138257698 CCAGGCAGTTGGGGGCCACAGGC 0: 1
1: 0
2: 1
3: 36
4: 330
Right 997953098 5:138257693-138257715 ACAGGCGGCAGCGCGCAGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997953094 Original CRISPR GCCTGTGGCCCCCAACTGCC TGG (reversed) Exonic
900639272 1:3681125-3681147 GCCTGTGGCTGCCACGTGCCGGG - Intronic
901594078 1:10370885-10370907 TCCTGTGGCCTCCAACTCCTGGG - Intronic
901934285 1:12617113-12617135 CCCTGCGGCCCCCCACTCCCTGG + Intronic
902381726 1:16055930-16055952 CCCTGTTGCCCCTCACTGCCAGG + Intronic
902551271 1:17220999-17221021 GCCTGGGGCACTCATCTGCCGGG - Intronic
902801969 1:18836106-18836128 TCCTGTGGCTCCCCAGTGCCTGG - Intergenic
903453229 1:23469349-23469371 GACTCTGGAGCCCAACTGCCTGG - Intronic
903560324 1:24222200-24222222 ACCAGTGGCCCCAAACTGCTGGG + Intergenic
903993804 1:27292332-27292354 GCCCGCTGGCCCCAACTGCCAGG - Exonic
905646242 1:39626698-39626720 GCCTGTCGCCCCCAGCAGCAGGG - Exonic
905772631 1:40648207-40648229 GAGTGTGTCCCCCAACTGCTTGG - Intronic
906496958 1:46311450-46311472 GCCTGTAGCCCCCAGCTACTCGG + Intronic
906515296 1:46435507-46435529 CCCTGGGGATCCCAACTGCCTGG - Intergenic
907358324 1:53894477-53894499 GGGTCTGGCCCCAAACTGCCCGG + Exonic
908570809 1:65408116-65408138 GACTTTGGACCCCAACTCCCTGG - Intronic
908880354 1:68724806-68724828 GCCTGTGCCTCCCAAGTGGCTGG - Intergenic
912350210 1:109005285-109005307 GCCTGTGGTCCCCAGCTACTTGG + Intronic
912507702 1:110167414-110167436 GGCTCTGGCCCCAGACTGCCTGG + Intronic
913141689 1:115947498-115947520 GCCTGTGGAAGCCAAGTGCCTGG + Intergenic
915268822 1:154737795-154737817 GCCTGTATCCCCCAGCTGCTCGG + Intronic
915463030 1:156081127-156081149 CCCTGGGGCCCCCAGCCGCCTGG - Intronic
915471118 1:156126395-156126417 GCCTGTTGCCCCCAGCAACCGGG + Intronic
916495709 1:165344897-165344919 GCCTGGGGCCCCCAGCTCCAGGG - Intronic
918104179 1:181402304-181402326 ACCTCTGTCCCCCAGCTGCCAGG - Intergenic
920684005 1:208095359-208095381 GCGTGTGGGCACCAACTGGCAGG + Intronic
920929861 1:210377094-210377116 GGCTGTGGCCCCCAACAGGCTGG + Intronic
922575453 1:226658329-226658351 GCCAGGGGCCCCTACCTGCCTGG - Intronic
922831288 1:228555758-228555780 GCCTGGCTCCCCCAAGTGCCCGG - Intergenic
923128872 1:231057462-231057484 GCCTGTGGAACCCAACGGCCAGG + Intergenic
1063485251 10:6414166-6414188 CCCTGTGAGCCCCAGCTGCCTGG - Intergenic
1066175905 10:32905586-32905608 GACTCTGGAGCCCAACTGCCTGG + Intronic
1067166703 10:43871118-43871140 GCCTGGAGCTGCCAACTGCCCGG + Intergenic
1067461089 10:46459215-46459237 GCCTGAGGCCCCCAATTCCTTGG + Intergenic
1067626105 10:47925386-47925408 GCCTGAGGCCCCCAATTCCTTGG - Intergenic
1069896364 10:71682650-71682672 GACTGTGGCCCCCACCTCCTTGG + Intronic
1070675621 10:78409593-78409615 GGCTCTGGACCCCAACTGCCTGG - Intergenic
1072660299 10:97359835-97359857 GCCTGTGGCACCCATGAGCCAGG - Intronic
1072800775 10:98390878-98390900 GCCTGTGTCCCCCTGCAGCCTGG - Intronic
1073057249 10:100710471-100710493 CCTTGTCACCCCCAACTGCCGGG - Intergenic
1073466257 10:103696135-103696157 GCCTGGTGACCCCCACTGCCAGG - Intronic
1074559955 10:114526783-114526805 GACTGAGGCTCCCACCTGCCTGG + Intronic
1074675205 10:115840616-115840638 ACCTTTAGCACCCAACTGCCTGG - Intronic
1076358587 10:129870493-129870515 TCCTGGGGCCCCGAGCTGCCAGG + Intronic
1076541932 10:131220209-131220231 GCCTATTGCCCCCAACAGCCTGG + Intronic
1076715431 10:132361681-132361703 GCCTGGGGCCCGCCACAGCCTGG - Intronic
1076726093 10:132413971-132413993 GCCTTGGGGCCCCACCTGCCTGG - Intronic
1076790762 10:132775540-132775562 CCCTGTGGCCCCCAACACCCAGG - Intronic
1076790772 10:132775585-132775607 GGGTGTTGCCCCCAACAGCCTGG + Intronic
1076793006 10:132786591-132786613 TCCTGTGGCCCCGACCTGCCCGG - Intergenic
1076830431 10:132991767-132991789 GCCAATGGCCCCCCAGTGCCTGG + Intergenic
1076843107 10:133056252-133056274 GCCTGTGGCCCCCAGTCCCCCGG - Intergenic
1077112242 11:866937-866959 GCCTGTGGCCCCCAGCCTCCTGG + Exonic
1077227131 11:1443296-1443318 CCCTGCGCCCCCCAACAGCCCGG + Intronic
1077331464 11:1985680-1985702 CGCTGTGGCCTCCAGCTGCCAGG - Intergenic
1077509261 11:2947485-2947507 GCATGTGGCCCACCCCTGCCAGG + Intronic
1078246154 11:9574314-9574336 GCCGGCGGCCCCCTACTTCCTGG + Exonic
1079936651 11:26625048-26625070 GCCTGTAGTCCCCAACTACTCGG - Intronic
1080234211 11:30050405-30050427 GACTGTGGTCCCCAGCTTCCTGG + Intergenic
1080258860 11:30323595-30323617 GCCTTTGGCCTCAAACGGCCAGG - Intronic
1080791629 11:35526663-35526685 GCCTGTGGGCCTAAGCTGCCCGG - Intronic
1080878583 11:36298697-36298719 GCCCGGGGCCCCCAACTCCCGGG - Intronic
1081011439 11:37817794-37817816 GCCTGTAGTCCCCAACTACTCGG - Intergenic
1081906464 11:46673507-46673529 GTGTGTGTCCCCCAACTGCCTGG + Intronic
1082811569 11:57482110-57482132 GGCTGTGGCCCCCTCCTCCCCGG - Intergenic
1083401358 11:62425574-62425596 GCCTTTGACCTCCACCTGCCCGG + Intergenic
1083604723 11:63971364-63971386 GCCTGTAGTCCCCAACTACTCGG + Intergenic
1084049772 11:66592127-66592149 TCCTGTGGCCCCCACCAGCAGGG - Exonic
1084461574 11:69299311-69299333 TCCTGTGGCCCCTCAGTGCCAGG + Intronic
1085484553 11:76850968-76850990 GCCTCTGGCACCAGACTGCCTGG + Intergenic
1087165436 11:94998395-94998417 CCATGTGGTCCACAACTGCCCGG - Exonic
1088709744 11:112497378-112497400 GCCTTTGGCTCCGAACTGCTGGG + Intergenic
1088906884 11:114161942-114161964 CCCTGTGGCCCCATTCTGCCAGG + Intronic
1202814445 11_KI270721v1_random:40856-40878 CGCTGTGGCCTCCAGCTGCCAGG - Intergenic
1092487393 12:8914529-8914551 GCCTGCGGCCCCCACCTTCTCGG + Intronic
1096946779 12:55415112-55415134 GCCTGCGGCCCCCACCTTCTCGG - Intergenic
1098858287 12:75678811-75678833 GCCTGTGCCACCTAACTTCCAGG - Intergenic
1099687402 12:85907882-85907904 GCCTCTGGCCACCTCCTGCCAGG + Intergenic
1100304666 12:93339361-93339383 GCCTGTGCCTCCCAAATGCTGGG + Intergenic
1100442157 12:94627245-94627267 GCCTGTTGCCCCCAAAGCCCTGG + Intronic
1101422976 12:104564568-104564590 TCCTGTGGCCCCTCACTGCAAGG + Intronic
1102059541 12:109922435-109922457 GCCTGTGGCCCACACTGGCCCGG + Intronic
1102108553 12:110346293-110346315 GTTTGTGGCCCGCAACTACCTGG + Exonic
1103514456 12:121498213-121498235 GCATGTGGGCCCCAAATGGCTGG + Intronic
1103884641 12:124191389-124191411 GCCTGTGGCCAATACCTGCCTGG + Intronic
1104348879 12:128027585-128027607 GACTGTGGAGCCCGACTGCCTGG + Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105739071 13:23303261-23303283 GACTGTTGCCCTGAACTGCCAGG - Intronic
1106049181 13:26174793-26174815 GCATGGAGCCCTCAACTGCCAGG - Intronic
1113802253 13:113092717-113092739 GCCTGTGGCTGCCCACTCCCAGG + Intronic
1118983907 14:70737400-70737422 GACTCTGGCACCAAACTGCCTGG - Intronic
1119087934 14:71754127-71754149 GCCGGAGGCCCCCAGCGGCCTGG - Intergenic
1119400381 14:74358606-74358628 GGCTGTGGCCCCCTCCTGCAGGG - Exonic
1119823517 14:77638919-77638941 GCCTGGGGCCCACCACTGCAGGG + Intergenic
1120180004 14:81333562-81333584 TCCTGTGGCAACAAACTGCCTGG - Intronic
1120322331 14:82980033-82980055 ACCTGTGTCCCACAACTGCAAGG + Intergenic
1121336652 14:93081872-93081894 GCCAGTGGGTCCCAAATGCCAGG + Intronic
1121530637 14:94650230-94650252 GCCTCAGTCCCCCATCTGCCAGG + Intergenic
1121885773 14:97541410-97541432 GCCTGTTTCCCCCACCTGCCTGG - Intergenic
1122800830 14:104228811-104228833 ACCAGTGTGCCCCAACTGCCTGG + Intergenic
1122880509 14:104688745-104688767 GCCAGTGGCCCCCAAACCCCAGG + Intergenic
1123044321 14:105503995-105504017 GCCTGGCGCCCCCACCAGCCCGG - Intergenic
1123821637 15:24036306-24036328 GCCTCTGCCTCCCAACTACCTGG - Intergenic
1124029970 15:26001592-26001614 GCCTGGGGCCCTCAGCGGCCTGG + Intergenic
1124053932 15:26224472-26224494 GCCTGTGACCAGGAACTGCCAGG + Intergenic
1124155760 15:27224111-27224133 CCCAGTGGCCTCCAACTTCCCGG + Intronic
1124789777 15:32717451-32717473 GCCCGAGGCCCCCAACTTCGAGG - Intergenic
1124814468 15:32975270-32975292 AATTGTGGTCCCCAACTGCCTGG - Intronic
1125502467 15:40248179-40248201 GCCTGGGGACCCCAAGGGCCTGG + Intronic
1125653998 15:41341002-41341024 GGCTGTGGCCCTCAACTGCATGG + Intronic
1125903987 15:43373616-43373638 GTCTCTGGAGCCCAACTGCCTGG - Intronic
1128305868 15:66598650-66598672 TTCTGTGGCCCCCAATCGCCCGG + Intronic
1128688079 15:69701982-69702004 GACTGTCTCCCCCACCTGCCTGG - Intergenic
1129452318 15:75658007-75658029 GCCTGTAGCCCCCTCCTGCAGGG - Exonic
1132469297 16:92996-93018 TCCTGTGTCCCCCATATGCCTGG - Intronic
1132698206 16:1211295-1211317 GTGTGTGGCCCCCACGTGCCCGG + Intronic
1132721728 16:1319882-1319904 GCCTGTGTTCCCAGACTGCCTGG + Intronic
1132753020 16:1467561-1467583 GCCTCTGACCCCCACCTCCCAGG + Intronic
1132977843 16:2719495-2719517 GCCAGGGGGCCCCACCTGCCAGG - Intronic
1133300092 16:4777139-4777161 GCCTGTAGTCCCCAGCTACCTGG + Intergenic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1134263888 16:12676160-12676182 GCCTGTGGCCCAGGACTGCCAGG + Intronic
1134720233 16:16376950-16376972 GCCTGAGCCCCACACCTGCCGGG + Intergenic
1134947194 16:18334935-18334957 GCCTGAGCCCCACACCTGCCGGG - Exonic
1135424024 16:22323457-22323479 GACTGTGGCTCCCAGCTGCATGG - Intronic
1136175654 16:28514550-28514572 TCCAGTGGCCCCCAGCTCCCAGG + Intergenic
1136542533 16:30936156-30936178 GCCTGAGGCCCCCCAAAGCCTGG + Intronic
1137620668 16:49874518-49874540 GCCTCTGCCTCACAACTGCCTGG + Intergenic
1138542129 16:57694912-57694934 GCTGGTGGCCCCCTTCTGCCTGG + Intronic
1139517852 16:67462276-67462298 GGGTGTGGCCCCCACCTCCCAGG - Intronic
1139603676 16:68002474-68002496 GGCTGTCCCCCACAACTGCCTGG - Intronic
1139799849 16:69513688-69513710 GCCTGTCTCCCTCACCTGCCAGG + Intergenic
1140435626 16:74944597-74944619 GCCTGTGGTCCCCATCTCTCAGG - Intronic
1141203553 16:81915212-81915234 ACCTGTGTTCCCCTACTGCCTGG - Intronic
1141461678 16:84181649-84181671 CCCTGTAGCCCTCACCTGCCCGG - Exonic
1141609185 16:85171432-85171454 GCCTGTGGACTCCACCGGCCTGG + Exonic
1142168456 16:88606579-88606601 GGCTGTGGCCCCCAACTACTCGG - Intronic
1142329542 16:89442648-89442670 GCCTGTGTCCCACAAAGGCCAGG + Intronic
1142343725 16:89540508-89540530 CCCTGTAGCCTCGAACTGCCAGG - Intronic
1143786648 17:9260694-9260716 GCCAGTGTCCCCCATGTGCCTGG + Intronic
1146692041 17:34883389-34883411 GCCTGGGGGCCCCACCTGACAGG + Intergenic
1147326117 17:39670405-39670427 CCCTGTGGCCCCCACCCACCTGG + Exonic
1147662307 17:42123215-42123237 GCCTCTGACCCACAGCTGCCCGG - Exonic
1147921144 17:43917840-43917862 GGCTGTGGCCCCCATCCGCATGG + Exonic
1148168600 17:45501464-45501486 GGCTGTGGCCCCCATCCGCATGG + Intergenic
1148280211 17:46341476-46341498 GGCTGTGGCCCCCATCCGCATGG - Intronic
1148302439 17:46559413-46559435 GGCTGTGGCCCCCATCCGCATGG - Intronic
1148380391 17:47192522-47192544 ACCTGTGGTCCCCAGCTGCTGGG + Intergenic
1148440395 17:47708978-47709000 CCCGGTGCCCCCCAGCTGCCCGG + Exonic
1148552684 17:48559968-48559990 GCCTGAGGCTCCCAACTCGCTGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1149645735 17:58240254-58240276 GCCTTTGCCCCTCAAATGCCAGG - Intronic
1151317081 17:73329554-73329576 GCCTCAGCCTCCCAACTGCCTGG - Intergenic
1151997284 17:77618046-77618068 GCCTATGGCCCCCATCATCCTGG + Intergenic
1152290698 17:79438446-79438468 GCATATGGCTCCCAACTCCCAGG + Intronic
1152353001 17:79793639-79793661 GACGGTGGCCCCCACCTCCCAGG - Exonic
1152740370 17:82016029-82016051 GCCTGTGGCCCTGAGCAGCCTGG + Intronic
1152825734 17:82463601-82463623 GCCAGTGGCCCCTGTCTGCCCGG - Intronic
1153947829 18:10032577-10032599 GCCTGCGGGCCCCACCTCCCCGG - Intergenic
1154219676 18:12441116-12441138 GCCTGTAGTCCCCAACTACTCGG + Intergenic
1154447749 18:14449233-14449255 GCCGGTGGCCCCCGGCTTCCAGG - Intergenic
1155474395 18:26223816-26223838 GCCTGTGGTCCCCAGCTACTTGG + Intergenic
1155529861 18:26756189-26756211 GCCTTTTCCCCCCAACTTCCTGG + Intergenic
1157296658 18:46449880-46449902 GACTCTGCCACCCAACTGCCTGG + Intronic
1158387597 18:57012799-57012821 GACTCTGGCCCCAGACTGCCTGG + Intronic
1158930923 18:62324967-62324989 GCCTGTGGGCCCCGCCTCCCGGG - Intergenic
1160782372 19:883536-883558 CCCAGTGACCCCCAGCTGCCAGG + Intronic
1160877131 19:1301883-1301905 CCCTGTAGCCTCCACCTGCCGGG - Intergenic
1161231975 19:3178948-3178970 GTCGGTGGCCGCCAGCTGCCTGG + Exonic
1161244322 19:3240906-3240928 GGCTGAGGTCCCCAGCTGCCCGG + Intronic
1161384561 19:3984070-3984092 CCCAGTGGCCTCCAGCTGCCAGG + Intronic
1161458035 19:4379753-4379775 GACTGTGACCCCTCACTGCCAGG + Intronic
1161512176 19:4677912-4677934 GCCTGGGGCCGCCAGCTGCCTGG + Intronic
1161688986 19:5719937-5719959 GCCATTGGCCCCCAATTGCCGGG + Exonic
1161846083 19:6712749-6712771 GCCTGTGCCCCCCATCAGACTGG + Intronic
1161846100 19:6712830-6712852 GCCTGTGACCCCCATCAGACCGG + Intronic
1163361279 19:16847668-16847690 GCCTGTGGCCTGAAGCTGCCAGG + Intronic
1163369297 19:16893203-16893225 GCCTGTGGGCCCCCACCACCCGG + Exonic
1163614086 19:18316470-18316492 GCCTGTTGTCCCCAGCTGCTTGG - Intronic
1164146483 19:22515610-22515632 GCCTCTGGTCCCGAGCTGCCTGG - Intronic
1164159883 19:22619524-22619546 GCCTCTGGCCCCGAGCTGCCTGG + Intergenic
1164491068 19:28714738-28714760 GCCTGTGGCCCACCACAGCTGGG - Intergenic
1165013886 19:32866953-32866975 ACCTGCTGCTCCCAACTGCCTGG + Intronic
1165102574 19:33447562-33447584 GCCTGTGCCCACCAGCAGCCTGG + Intronic
1165479151 19:36051764-36051786 GCCAGGGGTCCCCAACTCCCAGG + Intronic
1165825575 19:38703878-38703900 GCCTGCGACCCTCAACTGGCTGG - Intronic
1166071007 19:40387948-40387970 GCCTCTGCCCCCCAACTAACTGG + Intronic
1166333087 19:42089967-42089989 GCCTGTGGTCCCCATCTGAGAGG - Exonic
1167298230 19:48664207-48664229 GCCTGTGACCCCTAACTTGCAGG + Exonic
1167602309 19:50461497-50461519 TCCTGTGGCCCCGACCCGCCTGG + Intronic
1167606763 19:50485430-50485452 GCCAGTGCCTCCCACCTGCCCGG + Exonic
1168274784 19:55271627-55271649 GGCTGGGGCCACCATCTGCCAGG + Intronic
925005353 2:439083-439105 GCCAGTGCCCCCCACATGCCGGG - Intergenic
925044243 2:759266-759288 CACTGTGGCCTCCAACTTCCGGG - Intergenic
927571846 2:24166990-24167012 GCCTGTAACCCCAACCTGCCTGG - Intronic
928679034 2:33680431-33680453 GCTTGTGCCCACCAGCTGCCGGG + Intergenic
929591861 2:43152916-43152938 GCCTGTGGCCCCCAGGTAACCGG - Intergenic
930063654 2:47311140-47311162 GCCTGAGGCCCCCCACCTCCTGG - Intergenic
930742575 2:54847020-54847042 GCCTGTGCCCCCCAAGTAGCTGG + Intronic
934149351 2:89130565-89130587 GCCTGTGGTCCCCAGCTCCTTGG - Intergenic
934217943 2:90051476-90051498 GCCTGTGGTCCCCAGCTGCTTGG + Intergenic
934563478 2:95325137-95325159 GCCTGTGGACCCCACCAGCGTGG - Intronic
934662432 2:96150264-96150286 ACCTGTGGCCCCCAACCGATGGG + Intergenic
934736833 2:96693936-96693958 GCGTGTGGCCCCCAATGGTCTGG + Intergenic
936056159 2:109263841-109263863 GCCTGTAGTCCCCAGCTGCTCGG + Intronic
937149806 2:119678820-119678842 GCCTGTAGTCCCCAGCTGCTGGG - Intergenic
937292010 2:120787473-120787495 GCCTGTGGCTCCCGTGTGCCAGG + Intronic
937921210 2:127132959-127132981 CCCTGTGCCCCCCAACACCCTGG + Intergenic
938812892 2:134870011-134870033 GCCCCTGGCACCCAGCTGCCTGG - Intronic
938917325 2:135955778-135955800 GCCTGTAGTCCCCAGCTACCTGG - Intronic
939986290 2:148832667-148832689 GCCTGTGACGCCCATCTGCCTGG - Intergenic
941095281 2:161233269-161233291 GCCTGTGGCCTCCAGCTACTTGG + Intronic
943143089 2:184007379-184007401 GCCTCTGTCCCCCAACTCACTGG + Intergenic
943476925 2:188368329-188368351 GCCTATGCCCCCAAAGTGCCAGG - Intronic
947532165 2:230916397-230916419 GCCTGTGGTCCCCAACTATTTGG + Intronic
948197744 2:236107782-236107804 GCCTGGGGCCTGCACCTGCCGGG + Intronic
1169260637 20:4135799-4135821 GGCTGGGGCCGCCAACTTCCTGG - Intronic
1169946636 20:10996241-10996263 GCCTGTAGCACCAGACTGCCTGG - Intergenic
1171436977 20:25131458-25131480 GCCTGTGGCCTCTGAGTGCCAGG - Intergenic
1172228885 20:33323774-33323796 GCTTGTGGCCCCCTGCAGCCCGG + Intergenic
1173491085 20:43482381-43482403 GCCTGTGGGTCCCAGCTACCAGG - Intergenic
1173504158 20:43573947-43573969 GCCTGTGCCCCCCAACACCATGG - Intronic
1174054541 20:47788862-47788884 GCCTGCGGTCCCCACCGGCCTGG - Intergenic
1176126118 20:63475645-63475667 GGCTGTGACCGCCTACTGCCCGG + Intergenic
1176154390 20:63610937-63610959 GCATGTGGTCCTCATCTGCCAGG - Intronic
1176723679 21:10413123-10413145 GTCTGTCGCCACCAACTGCAGGG + Intergenic
1179150064 21:38802221-38802243 GCCTGTGGGCCCAGACTGCCTGG - Intergenic
1179587266 21:42381460-42381482 GCCAGTGCCTCCCACCTGCCTGG - Intronic
1179796865 21:43789880-43789902 GCCAGTGGACCCCGCCTGCCCGG - Intronic
1179994701 21:44968502-44968524 GCCTGTGGCGCCCGTCTCCCAGG + Intronic
1180179338 21:46111090-46111112 GTCTGGCGCCCCCCACTGCCTGG - Intronic
1180304835 22:11065900-11065922 GTCTGTCGCCACCAACTGCAGGG + Intergenic
1180877345 22:19180699-19180721 ACCTGTAGCCCCCAACCCCCTGG - Intronic
1180952911 22:19728796-19728818 CCATGTGGCCCCCACCTGTCTGG + Intergenic
1181474442 22:23159682-23159704 GCCTCTGGCCCTGAAATGCCAGG + Intronic
1181519036 22:23434809-23434831 TCCTGGGGCCCACAGCTGCCAGG + Intergenic
1181523015 22:23460112-23460134 GCCTGGGACCCCCAGCTGCCTGG + Intergenic
1182043986 22:27260060-27260082 GCCAGTGCCCACCCACTGCCTGG - Intergenic
1182713025 22:32334459-32334481 CCTTGTGTCCCCCCACTGCCTGG + Intergenic
1183101573 22:35587454-35587476 GCCTCTGGTCCCAATCTGCCAGG - Intergenic
1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG + Intronic
1183689150 22:39378515-39378537 GCTTGAGGCCCCCAGCTGCCTGG + Intronic
1184466063 22:44669323-44669345 GCCTGTGGCCCCCACCGCTCTGG + Intronic
1185331360 22:50253422-50253444 GACCCTGGCCCCCAGCTGCCGGG + Exonic
950188866 3:10962470-10962492 GCTGGTGGCCCCCAACTTCCTGG - Intergenic
950475880 3:13214544-13214566 GCCTGGGGCCTCTCACTGCCAGG + Intergenic
950604341 3:14064943-14064965 GCCTCTGCCCCCCATCAGCCTGG + Exonic
950750558 3:15124652-15124674 GCCTGGGGACCCCACCTCCCAGG + Intergenic
952160617 3:30689627-30689649 GCCTGTGACCCACCACAGCCTGG - Intronic
952419364 3:33117640-33117662 GGCTGTGGCCTCTAACTCCCCGG + Intronic
953737105 3:45504953-45504975 GCCTGTAGCCCCCAGCTACTAGG + Intronic
953766328 3:45746553-45746575 GCCTGTGGCCCTTCTCTGCCTGG - Intergenic
954093472 3:48303135-48303157 GGCTGTGGCCCTCATCTGCTGGG - Intergenic
954203096 3:49036936-49036958 GCCTATGGCCCCCAGCTACATGG + Intronic
954575424 3:51673337-51673359 GCCTCTGGCCCCAAGCTGCCTGG + Intronic
956173144 3:66448891-66448913 GCCTCTGGGCCACAACTGCAGGG + Intronic
956743315 3:72291681-72291703 GCCTGGGGCCCTCAGCTGTCCGG + Intergenic
961609239 3:128123547-128123569 GCTTGCAGCCCCCAACTCCCTGG + Intronic
963087965 3:141455850-141455872 GCCTGAGGCCCCTAGCAGCCTGG + Intergenic
963821779 3:149904504-149904526 GCCTGTAGCCCCCAGCTGCTGGG - Intronic
964973436 3:162589136-162589158 GCCTGTGGTCCCCAGCTACTGGG - Intergenic
966533599 3:181007326-181007348 GGCTGTGGACCCCAACTCCCAGG + Intergenic
966588670 3:181654924-181654946 GACTGTGGCCACCAATAGCCGGG + Intergenic
966832761 3:184024362-184024384 GCATGTGGCCCGCAGCTGTCAGG + Intergenic
967030474 3:185601682-185601704 GACTGTGCCACCAAACTGCCTGG - Intronic
968136172 3:196221014-196221036 GCCTGTGGTCCCCAGCTACTAGG - Intronic
968300192 3:197607032-197607054 GACTGTGGCCCTCACCTGACAGG + Intergenic
968500742 4:948711-948733 GTCTGGGGCCCACACCTGCCTGG + Intronic
968916478 4:3499096-3499118 TCCTGTGGCCACCCGCTGCCCGG - Intronic
969106903 4:4813559-4813581 GCCTGGTGCCCCCAATTCCCAGG - Intergenic
974808930 4:66920735-66920757 ATCTGTGGCCCCCAACTCCCGGG - Intergenic
976413327 4:84742542-84742564 GCCAGGGGTCCCCAACTCCCAGG + Intronic
982201771 4:152968449-152968471 GCCTGTAGCCCCCAGCTACTCGG - Intronic
984934038 4:184874290-184874312 ACCAATGTCCCCCAACTGCCTGG - Intergenic
985662512 5:1164201-1164223 GCCTGTGACCCTCAAGTGCAGGG + Intergenic
985796473 5:1966013-1966035 TCCTGTGGGCCACAGCTGCCTGG + Intergenic
989187675 5:38641099-38641121 GGCTGTGGGTACCAACTGCCTGG - Intergenic
992110091 5:73484632-73484654 GCCAGAGGTCCCCAACTCCCAGG + Intergenic
993896215 5:93538347-93538369 GCCTGTAGTCCCCCACTGCTCGG + Intergenic
995510102 5:112900675-112900697 GCCTGGGGCCCCCCACTCCTAGG + Intronic
997212359 5:132084823-132084845 GCCTGTAGTCCCCAGCTGCTTGG + Intergenic
997806668 5:136924658-136924680 GCCTCTGGCCCCTACCTGCCAGG + Intergenic
997934558 5:138098910-138098932 GCCTGTAGTCCCCAGCTGCTCGG + Intergenic
997953094 5:138257676-138257698 GCCTGTGGCCCCCAACTGCCTGG - Exonic
998038549 5:138936548-138936570 GGCTGTGGCCACCCACCGCCGGG - Intergenic
998053898 5:139057494-139057516 GCCTGCGGCCTCTGACTGCCAGG - Intronic
999152085 5:149432982-149433004 TCCTGGGGCCTCCAACTGCCAGG - Intergenic
999245885 5:150154567-150154589 GCCTATGGCTCCCCAGTGCCTGG - Intronic
999378503 5:151103702-151103724 GCCTGTGTCTCCCTCCTGCCTGG - Intronic
1000066690 5:157699512-157699534 CCCTGTGCCCCCCAAGTGCTGGG - Intergenic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002310436 5:178310576-178310598 GTCTGTGGCTCCCAAGTGCAAGG + Intronic
1002321086 5:178376446-178376468 GTGTGAGGCCCCCCACTGCCTGG + Intronic
1002334558 5:178468925-178468947 GCCTGTGGCACCCACCATCCTGG + Intronic
1002535818 5:179874795-179874817 GACTGTGCCCACCAAGTGCCAGG - Intronic
1005265442 6:24107583-24107605 GCCTGTGGCTGCCAGCTGCTAGG + Intergenic
1005682416 6:28219606-28219628 GCCTGTGGTCCCCAGCTACCTGG + Intergenic
1006299525 6:33186151-33186173 GTCTCTGGCCCCCACCTACCTGG - Intronic
1006729411 6:36225180-36225202 GCCTGTGGCCTCCACTTGACTGG - Intronic
1007478740 6:42136363-42136385 GGCTGGGGCCCCAAATTGCCAGG + Intronic
1007601310 6:43083353-43083375 TGCTCTGGCCCCCATCTGCCTGG + Intronic
1010259995 6:73804617-73804639 GCCTGTGGGCCAAATCTGCCTGG - Intronic
1013821772 6:114162584-114162606 GCCTGTGGCCTCCAAGTGATAGG - Intronic
1018257478 6:161936332-161936354 GCCTGTAGTCCCCAGCTGCTTGG - Intronic
1018582060 6:165316122-165316144 GCCTGTGGTTCCCAACTACTTGG + Intergenic
1018806899 6:167268815-167268837 GGCTGTGGCCTGAAACTGCCTGG + Intergenic
1018915141 6:168128466-168128488 GCCTCTGGCCTCCAAGCGCCCGG + Intergenic
1019262523 7:89502-89524 GCCTGTGCTCCCCAACTGTGGGG - Intergenic
1019312537 7:369732-369754 GCCTGTGCCCCACAACAACCCGG + Intergenic
1019588317 7:1816451-1816473 GCCTGGGACCCCCAACTGCCTGG - Intronic
1019592245 7:1841517-1841539 TCCTGGGGCCCACAGCTGCCAGG - Intronic
1019614513 7:1953069-1953091 CCCTGTGGCCCCCAGATCCCTGG - Intronic
1019634864 7:2070129-2070151 CCCTGAGGCCCGCTACTGCCAGG - Intronic
1019783664 7:2959591-2959613 GCCTGTCGCCACCACCTCCCCGG - Intronic
1019786378 7:2980076-2980098 GCCCGTGGCCCCCAGCTGGGTGG - Intronic
1020066922 7:5195358-5195380 GCCTGTGGTCCCCAGCTACTCGG + Intronic
1021231180 7:18087260-18087282 ACCGGTGGCCCCCAATTCCCAGG - Intronic
1022191404 7:28019802-28019824 GCCTGTGACCCCCAAAAGCCTGG - Intronic
1023419216 7:39961232-39961254 GCCTGTAGACCCCAACTACTCGG + Intronic
1023896096 7:44434233-44434255 GCCCTGGGCCCCCAGCTGCCAGG + Intronic
1024627666 7:51222072-51222094 GCCTGAGGCTCCCAACTGGCTGG - Intronic
1025026104 7:55517539-55517561 GCCTGAGGCCCCCAGCAGCAGGG + Intronic
1027658715 7:80963028-80963050 GCCTTTGGAGCCAAACTGCCTGG - Intergenic
1029116598 7:98240973-98240995 CCCAGTGGCCCCCATCAGCCTGG + Intronic
1029278993 7:99424830-99424852 GCCTGTGGCACCCGATGGCCAGG + Exonic
1032262081 7:130346336-130346358 GCATGTGGCTCCCACATGCCAGG - Intronic
1032308172 7:130756180-130756202 GCCAGTGGGGCCCAACTTCCAGG - Intergenic
1032707326 7:134432646-134432668 GCCAGGGGTCCCCAACTCCCGGG - Intergenic
1035729482 8:1844235-1844257 GTCTGTGCCCCCCAACTACGTGG + Intronic
1036646415 8:10613328-10613350 GTCTTTGGCCCCCAGCTCCCTGG + Exonic
1036765604 8:11547719-11547741 GCCTGAGGCCACCAGCAGCCCGG + Intronic
1037621383 8:20566568-20566590 GCCTGTGCTGCCCAAGTGCCAGG + Intergenic
1037799780 8:22025990-22026012 ACCAGGGGTCCCCAACTGCCGGG + Intronic
1039819365 8:41122542-41122564 GCCTGGAGCCCCCAGCTGCAGGG + Intergenic
1040285352 8:46097933-46097955 GGCTGTAGCCCCCAACTGGGGGG - Intergenic
1044858044 8:96495168-96495190 GCCTCTGTCCCCCAGCGGCCAGG - Intronic
1048867852 8:138773801-138773823 GCGTGTGACCCCCACATGCCTGG + Intronic
1049354727 8:142182090-142182112 GATGGTGGCCCCCAACTGCCTGG - Intergenic
1049453536 8:142675441-142675463 GCCTGTGGGCCCCAGCTGGGTGG + Intronic
1049469782 8:142770158-142770180 GCCTGTGGCCGTCACCTGCCTGG - Intronic
1049474600 8:142790841-142790863 GCCTGTGGGCACCACCAGCCAGG - Intergenic
1049661634 8:143822133-143822155 GCCTGGGCCCCACAACTGCTCGG - Intronic
1050289582 9:4139924-4139946 ACCAGGGGTCCCCAACTGCCTGG - Intronic
1053276363 9:36786586-36786608 GCCTGTGTTCCCCCTCTGCCTGG - Intergenic
1053732792 9:41074505-41074527 GCCGGGGGCCCCCACCAGCCTGG + Intergenic
1054142576 9:61540878-61540900 GCCTGTGGATCCCTACAGCCTGG - Intergenic
1054916950 9:70503493-70503515 TCCTGTCCCCCCCAACTCCCGGG + Intergenic
1059061469 9:111038454-111038476 GCCAGTCGGCCCCTACTGCCCGG + Intronic
1060593567 9:124834628-124834650 TCCTGTGGCTCCCTGCTGCCCGG - Intergenic
1060599435 9:124868513-124868535 TCCTGGCGCCCCCAACTGCCTGG + Exonic
1060778551 9:126394644-126394666 GGCCGTGGCCTCCAGCTGCCAGG - Intronic
1060794559 9:126505044-126505066 TCCTGCTGCCCCCACCTGCCAGG - Exonic
1060980387 9:127788436-127788458 GCCCCTTCCCCCCAACTGCCAGG + Intronic
1061202422 9:129145622-129145644 TCCTGAGGCCACCTACTGCCAGG - Intronic
1061235118 9:129337593-129337615 GCCTGTGCCCCAAATCTGCCCGG + Intergenic
1061420739 9:130471854-130471876 GCCTGTGCCCACCAGCTCCCAGG + Intronic
1061498725 9:130990334-130990356 GCCTGGAGCCCCCCACTTCCAGG + Intergenic
1061509352 9:131050985-131051007 GCATGTGGCCACCAGCTCCCGGG + Intronic
1062181659 9:135194246-135194268 GTCTGTGTCCTCCTACTGCCTGG - Intergenic
1203791452 EBV:153909-153931 GTTTGTGGCCCCCATCTCCCTGG - Intergenic
1185449956 X:276587-276609 GCCTGTGGCTGCCAACGTCCAGG - Intronic
1194089472 X:89567203-89567225 TCCTGTGGCCCCCCACTGAGAGG + Intergenic
1196404766 X:115349569-115349591 TACTGTGGAGCCCAACTGCCTGG + Intergenic
1199593433 X:149488601-149488623 GCCTGGGGGCCCCCTCTGCCTGG - Intronic
1199598584 X:149526830-149526852 GCCTGGGGGCCCCCTCTGCCTGG + Intronic
1199690815 X:150307932-150307954 CCCTGTGGCATCCCACTGCCTGG + Intergenic
1199991577 X:152990322-152990344 GCCTGTGGCCCCTCCCTGCCTGG + Exonic
1200442132 Y:3223257-3223279 TCCTGTGGCCCCCCACTGAGAGG + Intergenic
1201554203 Y:15251471-15251493 GCCTCAGCCTCCCAACTGCCTGG - Intergenic