ID: 997956879

View in Genome Browser
Species Human (GRCh38)
Location 5:138285745-138285767
Sequence CCCCTTCCTGCACTTTGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997956875_997956879 -8 Left 997956875 5:138285730-138285752 CCCGCAGCTGCCGCTCCCCTTCC 0: 1
1: 1
2: 1
3: 75
4: 647
Right 997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 282
997956874_997956879 10 Left 997956874 5:138285712-138285734 CCAGAAGGGCAATCTGCTCCCGC 0: 1
1: 0
2: 1
3: 3
4: 86
Right 997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 282
997956876_997956879 -9 Left 997956876 5:138285731-138285753 CCGCAGCTGCCGCTCCCCTTCCT 0: 1
1: 0
2: 7
3: 63
4: 670
Right 997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 282
997956873_997956879 16 Left 997956873 5:138285706-138285728 CCTTCACCAGAAGGGCAATCTGC 0: 1
1: 0
2: 3
3: 29
4: 392
Right 997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997956879 Original CRISPR CCCCTTCCTGCACTTTGCTC TGG Exonic
901475799 1:9488414-9488436 CCCCATCCTTCCTTTTGCTCAGG - Intergenic
901700675 1:11043523-11043545 CTCCTTCCAGCCCTGTGCTCCGG - Exonic
902816183 1:18918010-18918032 CCGCTTCCTGCCCCTTCCTCTGG - Intronic
903269037 1:22176464-22176486 CCACGTCCTTCACTTTGCTCGGG - Intergenic
905227244 1:36487248-36487270 CCGCCTCCTGGCCTTTGCTCAGG + Intergenic
906660132 1:47576064-47576086 CCCCTTCACTGACTTTGCTCTGG + Intergenic
906791693 1:48664107-48664129 CCCCTCTCTGCTCTTTGGTCTGG - Intronic
906817624 1:48895323-48895345 GATCTTCCTGCACTTTCCTCTGG + Intronic
907790862 1:57662104-57662126 CCCCTTCCTCCACTTTTTTTGGG + Intronic
907910306 1:58820056-58820078 CTCCTTCCTGGCCGTTGCTCAGG + Intergenic
907934794 1:59032598-59032620 CCCCTCCCTGCACTATTCTAAGG - Intergenic
908183368 1:61627788-61627810 TCCCCTCCTGCACTTCGATCTGG - Intergenic
908967871 1:69787640-69787662 CCCCTTTCTGCACATAGCACGGG + Intronic
909016734 1:70388145-70388167 CCCTTTCCTGCACTGTGGTCTGG + Intergenic
910724525 1:90324537-90324559 CCCCTTCCTGCAGAGTTCTCTGG - Intergenic
912747168 1:112254511-112254533 CCTCTGCCTGCACTTGGCTTTGG - Intergenic
913182952 1:116340237-116340259 TCCCCTCCTGCACTTTACTAAGG - Intergenic
914665921 1:149832498-149832520 CCTCCTCCTCCACTCTGCTCAGG - Intergenic
914669844 1:149861296-149861318 CCTCCTCCTCCACTCTGCTCAGG + Intronic
915450950 1:156004838-156004860 CCCCTTCCTGTACTCGGCTTTGG - Intronic
915816905 1:158977219-158977241 CCCCTACCTGCCCCTTGGTCTGG - Intergenic
915954915 1:160213482-160213504 CCTCTTCCTCCCCCTTGCTCAGG - Exonic
917299677 1:173560365-173560387 CCTCTCACTGCACATTGCTCTGG + Intronic
919905410 1:202075211-202075233 CCCCTCTCTGCCCTGTGCTCTGG + Intergenic
920185662 1:204157599-204157621 CTCCTCACTGCACTTGGCTCAGG + Intronic
921046876 1:211484099-211484121 CCCCTGACTGCACTCTGCACAGG + Intronic
921966864 1:221099623-221099645 CCCCTTCTTGGACTTTTCACAGG - Intergenic
922580188 1:226691496-226691518 CCCCTTCCTGCTGTTGACTCAGG - Intronic
923698202 1:236275600-236275622 CCCCTTCCTGCAGATTGGTGGGG + Intronic
924320215 1:242841025-242841047 CCCCTTCCATCAAATTGCTCAGG - Intergenic
1065063045 10:21927948-21927970 TCCCTTCCTTTACTCTGCTCCGG - Intronic
1065084008 10:22156116-22156138 CCCCATCCTGCTCTTCACTCAGG + Intergenic
1065270444 10:24027240-24027262 CCCCTCCCTGCACTATGACCTGG + Intronic
1065569429 10:27054801-27054823 CCCCTTTCTGCCCTTTTCTCTGG - Intronic
1068989913 10:63139580-63139602 GCCCTTCCTGCACCTTTCTTTGG - Intronic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1070148231 10:73789841-73789863 CCCCCTCCTGCAATTAGCTCCGG + Intronic
1070409392 10:76125602-76125624 CCCCTACCTTCACTGTACTCTGG - Intronic
1073496699 10:103898242-103898264 CCCCTTCCTGTCCTATCCTCCGG + Intronic
1074418385 10:113287039-113287061 CCTCTGCTTGCCCTTTGCTCAGG + Intergenic
1074899107 10:117801519-117801541 CCCCCTGCTGCCCTTTCCTCTGG + Intergenic
1075957259 10:126534753-126534775 CCCATTCCTTCAATTTGCTGAGG - Intronic
1077233797 11:1470324-1470346 CCACTTCATCCTCTTTGCTCGGG - Exonic
1078170539 11:8925926-8925948 CCCCTTGCTGCTCTCTGCTAGGG - Exonic
1080049944 11:27849165-27849187 CCCCTTTCTTCACTTTGATTGGG - Intergenic
1080144707 11:28967710-28967732 CCCTTTCCTGCTTTTTACTCTGG + Intergenic
1080201622 11:29678096-29678118 CCCATTACTACACTTTGCTTTGG + Intergenic
1080592248 11:33734602-33734624 GCCTTTCCTGCAGTTTGTTCCGG + Intronic
1080622265 11:33996712-33996734 CCCACCTCTGCACTTTGCTCTGG + Intergenic
1080873655 11:36258387-36258409 CTCCTCCCTGCACTTTCCCCAGG - Intergenic
1080999285 11:37647914-37647936 CATCTTCCTGCACATTGCTTTGG - Intergenic
1081574816 11:44312331-44312353 CTCATTCCTGCACTTTTGTCTGG + Intergenic
1083096891 11:60260151-60260173 TCCCTGCCTCCACTGTGCTCTGG + Intergenic
1083105560 11:60355084-60355106 CCCTTGCCTCCACTGTGCTCTGG - Intronic
1083628558 11:64084423-64084445 CCCCTCCCTGCACTGTGGGCAGG + Intronic
1083887864 11:65581517-65581539 CCCCCTCCTGCTCTCTTCTCAGG + Exonic
1084408271 11:68991476-68991498 CCCCATCCCCCACTCTGCTCTGG + Intergenic
1085550006 11:77360346-77360368 CCTCTTCCTTCACATTCCTCAGG - Intronic
1086584860 11:88438983-88439005 TCCTGTCCTGTACTTTGCTCTGG - Intergenic
1088401401 11:109424628-109424650 CCCCTCCCCTCCCTTTGCTCCGG - Exonic
1089581696 11:119485371-119485393 CCACTGCCTGCACCTCGCTCAGG + Intergenic
1090164649 11:124534327-124534349 CCTTTTCCTGGACTCTGCTCTGG - Intergenic
1091384013 12:80816-80838 CCTCCTCCAGGACTTTGCTCAGG - Intronic
1091833959 12:3571160-3571182 CCCCTTTCTGCCCCTGGCTCTGG + Intronic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097102425 12:56599063-56599085 CCCCTCCCAGCCCTTTCCTCTGG + Intronic
1097267491 12:57754893-57754915 CCCCTTCCTCCACCCTCCTCGGG + Intronic
1097282941 12:57856396-57856418 CCCATCCTTGCACTTTCCTCTGG + Intergenic
1098213050 12:68186335-68186357 CCCTCTCCTTCACTTTGCCCTGG - Intergenic
1098532672 12:71558402-71558424 CCCCTTCCTCTACCTTGCCCAGG + Intronic
1098926171 12:76351182-76351204 CCCATTCTTGCTCTCTGCTCAGG - Intergenic
1104131184 12:125895870-125895892 TCTTTTCCTGGACTTTGCTCAGG + Intergenic
1105948181 13:25207399-25207421 CCCCTTCGTCCACTGGGCTCTGG + Intergenic
1107803303 13:44130896-44130918 CCCCTTCCTGCCGTGTGCTGGGG + Intergenic
1108071869 13:46636623-46636645 CCCCCTCCACCACTTTTCTCAGG + Intronic
1112055338 13:95685230-95685252 CCCCTTGCTGCAATATGCCCTGG + Intronic
1113740566 13:112710017-112710039 CCTCTGCCTGCACTCTGCCCTGG + Intronic
1115008176 14:28511611-28511633 CCCCTCCCTGCACCAAGCTCAGG + Intergenic
1116780157 14:49228097-49228119 CCCATTCCTGCAGTTTGATGAGG - Intergenic
1117066079 14:52014364-52014386 CACCTTCCTGCTCTATACTCAGG - Exonic
1119472242 14:74907375-74907397 CCCCTCCCAGCACCTTCCTCAGG + Intronic
1121722825 14:96122844-96122866 CCCCTCCCAGCACTTTGATTTGG + Intergenic
1122975949 14:105170826-105170848 CCCCCTGCTGCACCTTGCTGGGG + Intergenic
1123475957 15:20592744-20592766 GCCCCTCCAGCACTTGGCTCAGG - Intergenic
1123642054 15:22407619-22407641 GCCCCTCCAGCACTTGGCTCAGG + Intergenic
1123780429 15:23621404-23621426 CCCTTTCCTTCACTATGCTTAGG - Intronic
1127315684 15:57791908-57791930 TCCCTTTCTGGACTATGCTCTGG - Intergenic
1127381334 15:58433246-58433268 GCCTTTCCTGCCCTTTGCCCCGG + Intronic
1127469022 15:59273860-59273882 CCCCTCCCTGCTCACTGCTCGGG + Intronic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1129598434 15:76982857-76982879 CCCATTCCTGCCCATTCCTCTGG - Intergenic
1129690947 15:77713003-77713025 CCCCTTCCTTCATTATGCTGGGG + Intronic
1129699446 15:77759220-77759242 CCCCTTCCTTCACTGGCCTCTGG + Intronic
1131841822 15:96445604-96445626 CACCTACCTGCACCTTGCACGGG - Intergenic
1132014061 15:98300399-98300421 CCCTTGCATCCACTTTGCTCTGG + Intergenic
1132585142 16:702895-702917 CCCCTTCCCTCTCTTGGCTCAGG - Intronic
1132632257 16:924280-924302 TCACTTCCTGCACTTAACTCTGG - Intronic
1132744939 16:1432653-1432675 CCCCTTCCTGCCCTCAGATCCGG + Intergenic
1132893064 16:2214071-2214093 CCCCTCCCTGCCCTTTGACCCGG - Intronic
1136648635 16:31645808-31645830 CCCCTTCCATCAATTTGCCCAGG - Intergenic
1138460527 16:57145006-57145028 AGCCTTCCTGCACTTCACTCAGG + Intronic
1138593699 16:58017795-58017817 CACCTTCCTGCACCTTGCCCAGG + Intronic
1139658362 16:68403096-68403118 CTCCCTCCTTCACTTTGTTCAGG + Intronic
1142164548 16:88579173-88579195 CCACTTCCTACACTTCGCTGCGG - Intronic
1142607609 17:1090765-1090787 CTCCTTCCTGCCCTGTTCTCTGG - Intronic
1143366554 17:6412534-6412556 CTCCTTCCTGCACCCTGCTCTGG - Intronic
1143417401 17:6759763-6759785 CCCCTTCCTCTCCTTTTCTCAGG - Intronic
1143867907 17:9937466-9937488 CCCCTTCCTGCCCCTATCTCAGG + Intronic
1144773505 17:17772300-17772322 CCCCTGCCACCACTTTGGTCTGG + Intronic
1144802656 17:17941290-17941312 CCTCTTCCTGCACTTCCCTCTGG - Intronic
1144876895 17:18402333-18402355 TCCCGTTGTGCACTTTGCTCTGG - Intergenic
1145155334 17:20542080-20542102 TCCCGTTGTGCACTTTGCTCTGG + Intergenic
1146529098 17:33592689-33592711 CCTCCTCCTTCACTTTGGTCCGG - Intronic
1146578437 17:34014462-34014484 CCACTCCCTGCATTCTGCTCAGG - Intronic
1148336090 17:46842114-46842136 CCCCTTCCCACTCTATGCTCTGG + Intronic
1150892165 17:69164985-69165007 TACCTTCCTTCACTTTGCTGGGG - Exonic
1151713167 17:75818185-75818207 CCCCTTCCTCCCCTCTGCTGTGG + Intronic
1152024139 17:77797802-77797824 TCCCTCCCTGCACTCAGCTCCGG + Intergenic
1152317354 17:79588912-79588934 CCCCGTCCTGCACTTGGACCTGG + Intergenic
1152495233 17:80666475-80666497 GCCCTTCCTACACTCTGCCCAGG - Intronic
1153132125 18:1866076-1866098 TCTCTGCCTGGACTTTGCTCAGG - Intergenic
1153659846 18:7316982-7317004 CCCCATCCTGCTCTGAGCTCTGG + Intergenic
1155057075 18:22194386-22194408 ACCCTCCTTGCACTTTGATCAGG + Intronic
1156042150 18:32834939-32834961 CCCTTTCCTGCACTCTTCTCTGG - Intergenic
1160804781 19:987752-987774 CCCCTTCCTGTTCTTGGCTCGGG + Intronic
1161518385 19:4709974-4709996 CCCCTGCCAGCACATTCCTCGGG + Intronic
1161585273 19:5102342-5102364 CTCCTTCCTGCAGTTGCCTCTGG + Intronic
1163248675 19:16112727-16112749 ACCATTCCTGCTCTTTTCTCTGG + Intronic
1164676983 19:30107507-30107529 CCCCTTCCTTCCCCTTGCTGGGG - Intergenic
1166097725 19:40551502-40551524 CCCCCTCCCCCACCTTGCTCAGG - Intronic
1166184701 19:41132422-41132444 ACTCTTCCTCCATTTTGCTCGGG - Intergenic
1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG + Exonic
1168493315 19:56829567-56829589 CCTCTTCCTGCCTTTGGCTCTGG - Intronic
1168709612 19:58491469-58491491 CCCCTTCCTGGGGTTTGCACAGG + Intronic
925334192 2:3080850-3080872 CCCCTCCCTGCCCTTCCCTCAGG - Intergenic
926048028 2:9724521-9724543 GTCCTTCCTGCACTAAGCTCAGG + Intergenic
926911103 2:17852964-17852986 CCCCTTGCTGCACATTGCTGTGG - Intergenic
927212151 2:20645557-20645579 GCCCTGCCTGCACTTTGCTCGGG - Intronic
927840470 2:26438884-26438906 CCCATTCCTGCATTTCACTCGGG + Intronic
929248305 2:39726323-39726345 ACCCTTCCTGGACATTCCTCAGG - Intergenic
929255086 2:39802045-39802067 CCCCCTCCTGCATTTCTCTCAGG + Intergenic
932361506 2:71111781-71111803 CCCCTTCCTGCACTGCAGTCTGG + Intronic
934041361 2:88129893-88129915 CCCCTTCCTGCCCGCTGTTCAGG - Intergenic
934712052 2:96522746-96522768 CTGCCTCCTGCCCTTTGCTCAGG - Intergenic
936507234 2:113117339-113117361 CCCCTTCCTTGACATTGCTCAGG + Intronic
937795276 2:126010437-126010459 CCCCTTCCTGTGCTTCCCTCAGG - Intergenic
939142230 2:138368639-138368661 CCCCTTCCTGCAGTCTGCAGTGG + Intergenic
942487162 2:176451945-176451967 CCCCTCCCTGCACTCCCCTCTGG + Intergenic
942881696 2:180869566-180869588 CTCTTTCCTGTTCTTTGCTCTGG + Intergenic
943876657 2:193074576-193074598 CCCCTTTCTGCACTGCTCTCAGG + Intergenic
945154371 2:206823184-206823206 CCCCTTCCTGCATTGTTCCCAGG - Intergenic
946164967 2:217858264-217858286 CCCCTTCCTGGACTTGCTTCTGG - Intronic
947529366 2:230899007-230899029 CCCTTTCCTGCAGTGTGCCCTGG - Intergenic
947716095 2:232339527-232339549 CTCCTTGCTGCACTGTCCTCAGG - Intronic
948574669 2:238942042-238942064 CTGCTTGCTGCATTTTGCTCTGG - Intergenic
948989929 2:241548554-241548576 ACCCTTCCTGCACTCGGCTCAGG + Intergenic
949076748 2:242064077-242064099 CCACTTCCTGCACAGTGCGCGGG + Intergenic
1168775543 20:444329-444351 CCCTCTTCTGCACTGTGCTCTGG - Intronic
1169022379 20:2339787-2339809 CCCCTGCCTGCACCTTGGTGAGG - Intronic
1169900912 20:10550836-10550858 CCCCTTCCCTCACCTTCCTCAGG + Intronic
1170504442 20:17010350-17010372 CCCCTCCCTGCACTTTGAAAGGG - Intergenic
1170686735 20:18576154-18576176 CAACTTCCTGCACTTCACTCAGG - Intronic
1171208273 20:23297971-23297993 CCCCTTCCTAGGCTTTGCTGTGG - Intergenic
1173002142 20:39112047-39112069 CCCTTTCCTTCTCCTTGCTCTGG + Intergenic
1173070835 20:39763467-39763489 TGGCATCCTGCACTTTGCTCTGG - Intergenic
1173314458 20:41930958-41930980 CCCCTTCCACCAATGTGCTCTGG - Intergenic
1173350675 20:42242514-42242536 ACCCTTCCTGACCTTTGATCTGG - Intronic
1174187543 20:48717298-48717320 CCCCTTCCTGGAGTTGGCTGAGG - Intronic
1174407201 20:50310172-50310194 CCCGCCCCTGCCCTTTGCTCAGG + Intergenic
1176075498 20:63246477-63246499 CTCCTTCCTGGGCTCTGCTCTGG - Intronic
1178499150 21:33111197-33111219 CCCACTCCTGGCCTTTGCTCTGG - Intergenic
1179810398 21:43865745-43865767 CTCCGTCCTGGACTCTGCTCCGG + Intronic
1181417410 22:22770678-22770700 CACCTCCCTGCCCTTTTCTCTGG + Intronic
1181423476 22:22817968-22817990 CCCCTCCCTGCCCTTTGCTCTGG + Intronic
1181957654 22:26599805-26599827 TCCCTTCCTGCTCTGTGCCCTGG + Intronic
1182310582 22:29402801-29402823 CGCCCCCCTGCACTTTTCTCAGG + Intronic
1182690468 22:32157945-32157967 CGCCCCCCTGCACTTTTCTCAGG - Intronic
1183585437 22:38750618-38750640 CCCATTCCAGCACTTTCCTGTGG - Intronic
1183899806 22:40996504-40996526 CCCCTGCCTGGGGTTTGCTCGGG - Intergenic
1184101992 22:42345572-42345594 CCACCTCCTGGACTTAGCTCTGG - Intergenic
1184171928 22:42765050-42765072 CCTCTTCCTGCCCTTTCCTGTGG - Intergenic
1184238977 22:43201833-43201855 CCCCTCCCGGCACCTTCCTCAGG + Exonic
949276581 3:2290254-2290276 CCCCTTCCTGCATTATGGCCCGG - Intronic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950207759 3:11093501-11093523 CCTTTGCCTGCATTTTGCTCTGG - Intergenic
950358076 3:12428477-12428499 CCTCTCCCTGCACCTTGCTGAGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950535760 3:13577294-13577316 CCCCTTTCAGCTCTCTGCTCGGG - Intronic
951407332 3:22316912-22316934 CCCCTTCCTGCACTTGGTGAAGG - Intronic
953235941 3:41107152-41107174 TTCCTTCCTGCAGCTTGCTCTGG + Intergenic
955094162 3:55781176-55781198 TCCCTTCCTGCATTGTGCTGTGG - Intronic
956166953 3:66404420-66404442 CCCCTTCCTGCACGGTCCTTGGG + Intronic
960807498 3:121598215-121598237 CACCCTTATGCACTTTGCTCTGG - Intronic
961108002 3:124258566-124258588 CCTCTTCCTGGATTTTGCTGGGG + Intronic
961563443 3:127746891-127746913 CTCCTTCCTGAATTTTCCTCAGG + Intronic
961602659 3:128073236-128073258 CCCCTTGCTGCCCTTGGCTCAGG + Intronic
962731745 3:138289933-138289955 TCCCTTCTTGCACTTTGTTTTGG - Intronic
964622949 3:158733707-158733729 CTCCATCCTGCATTTTGTTCAGG + Intronic
968441382 4:626246-626268 CCCCTCCCGGCACTGTGCCCTGG + Intronic
968481840 4:836762-836784 CCCCTTCCTGCACTCAGTCCTGG + Intergenic
968592360 4:1465456-1465478 CCCTCTCCTGCCCCTTGCTCTGG - Intergenic
968596071 4:1486115-1486137 CCCCTCCCTGCACCATGGTCTGG + Intergenic
969276208 4:6137499-6137521 CCCCTTCAAGTCCTTTGCTCAGG + Intronic
969523303 4:7691396-7691418 CCACTCCCTGCACTCTGGTCTGG - Intronic
969567283 4:7985950-7985972 CCACTTCCTGCCCCTTGCTGGGG + Intronic
972826341 4:42764055-42764077 CCTCGTTCTTCACTTTGCTCTGG + Intergenic
973070337 4:45850504-45850526 CCCCTTCCCACACTTTCCCCCGG + Intergenic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
976128540 4:81858841-81858863 CCCCTTCCTCTACTTTGCCAGGG + Intronic
977499464 4:97821304-97821326 CTCCTTACTGCAGTTTGCCCTGG - Intronic
978831095 4:113085779-113085801 CCCCTTCCTCCAAATTTCTCAGG - Intronic
981478721 4:145213961-145213983 CCCCTGCCTGGGCCTTGCTCAGG + Intergenic
981749228 4:148077347-148077369 CCCCATCGTTCACTTTGCTTTGG + Intergenic
981834288 4:149037188-149037210 CCTCTTCCTTCTCTATGCTCTGG + Intergenic
982126669 4:152189739-152189761 CCCCTTCCTGCTGTTCCCTCAGG + Intergenic
982691842 4:158556923-158556945 CCCCATCCTTCTCTCTGCTCTGG - Intronic
985158510 4:187019106-187019128 CCCTTCCCTGCATTGTGCTCTGG - Intergenic
985929942 5:3049390-3049412 CCCTTTCCTGCAGTTAGCACAGG - Intergenic
988198814 5:28044833-28044855 CCCCTTCCATAACTTTCCTCAGG - Intergenic
988448277 5:31312220-31312242 TCTCTTCCTGAACTTTTCTCAGG + Intronic
988788930 5:34589720-34589742 TGCCCTCCTGCACTCTGCTCTGG + Intergenic
989984377 5:50680232-50680254 CAACTTCCTCCCCTTTGCTCAGG + Intronic
990211305 5:53483182-53483204 CCCCTTCCTGTCCCTTGCCCTGG + Intronic
990261011 5:54022375-54022397 CACCTTCCTGCACTTTGGGAGGG - Intronic
990302193 5:54460077-54460099 CTCCATCCTGCCCTTTGCCCTGG - Intergenic
990365529 5:55066594-55066616 CCCGCTCCTCCACTTTGCACAGG + Intergenic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
991947648 5:71915239-71915261 CTCCTTCCTGCTCTTTCCCCTGG + Intergenic
992809285 5:80370613-80370635 GCCCTTCCTTTACTCTGCTCTGG - Intergenic
994002013 5:94791872-94791894 CCTCTTCCAGCACCTTTCTCAGG + Intronic
997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG + Exonic
998175980 5:139902383-139902405 CCTCTTCCTGCTATTTGCTAAGG + Intronic
1000480711 5:161770005-161770027 CCCCTTCCTGCTATTTCCTGTGG - Intergenic
1000678018 5:164146526-164146548 CCCTTCCTTGCAGTTTGCTCTGG - Intergenic
1001592934 5:172878746-172878768 CGCCTGCCTCCACTTGGCTCTGG + Intronic
1002212686 5:177608129-177608151 CCCATTCTTGCACCTGGCTCAGG - Intronic
1003377771 6:5595051-5595073 CCCCTTCCTGCACTCTACGGTGG - Intronic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1005486998 6:26310084-26310106 CCGCTTCTTGCTCTTTTCTCTGG - Intergenic
1006457397 6:34139721-34139743 CCCTGTCCTGGGCTTTGCTCTGG - Intronic
1007149483 6:39674354-39674376 TCTCTTTCTGCATTTTGCTCAGG - Intronic
1007989073 6:46236203-46236225 CCCCTTACTGCTCTTTGCAATGG - Intronic
1008054382 6:46931160-46931182 CCCCTTCTTCCACTGGGCTCTGG + Intronic
1008060331 6:46990158-46990180 ACCCCTCCTCCACTTTGCCCAGG + Intergenic
1008642989 6:53483840-53483862 GCCCTCACTGCACTTTGCACAGG + Intergenic
1010849518 6:80754822-80754844 CACCTTCCTTCTTTTTGCTCAGG + Intergenic
1016401787 6:143688988-143689010 CATCTTCCATCACTTTGCTCTGG + Intronic
1017813874 6:158003000-158003022 CCCCTCCCTGCACTGAGCTGTGG - Intronic
1018206910 6:161445025-161445047 CCCCTGCCTACATTTTACTCTGG + Intronic
1018493191 6:164318443-164318465 AGCATGCCTGCACTTTGCTCTGG + Intergenic
1018803018 6:167237898-167237920 TCTCTTTCTGCTCTTTGCTCTGG - Intergenic
1018807564 6:167273144-167273166 TCTCTTTCTGCTCTTTGCTCTGG + Intronic
1019298900 7:293458-293480 TGAGTTCCTGCACTTTGCTCTGG + Intergenic
1020002850 7:4765502-4765524 CACATTCCTGCACATTGCCCGGG - Exonic
1020110291 7:5443980-5444002 ACCCTGCCTGCACCTTGATCTGG + Intronic
1022404260 7:30071963-30071985 CCCCTTTCTTCACATTTCTCAGG + Intronic
1022449774 7:30504330-30504352 CCCCCTCCTGGCCTTTGCACCGG - Intronic
1023872102 7:44268800-44268822 TCTCTTCCTGCACTTGGCTGTGG - Intronic
1026095720 7:67345029-67345051 CCCCTTACTGCACATTTGTCAGG - Intergenic
1027501715 7:78960176-78960198 CCCTTTCCTGCAGTTTTATCAGG - Intronic
1029189312 7:98760598-98760620 CCTCTTCCTGGACTTTGTCCTGG + Intergenic
1030310783 7:108067268-108067290 CCCCTTCCTGGGCATTGCTTGGG - Intronic
1034245764 7:149643223-149643245 CCACATCCTGCACCTTGCCCTGG - Intergenic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG + Intergenic
1034990396 7:155544348-155544370 CCCCTTCCAGCCCCTTCCTCAGG + Intergenic
1035667767 8:1391597-1391619 CCCCTTCCTGGACTCTGCATGGG - Intergenic
1036054066 8:5230621-5230643 GCCCTTCTTGCCCTTTGTTCTGG - Intergenic
1036619571 8:10415698-10415720 GCCCTCCCTGCACTCTCCTCCGG + Intronic
1037780113 8:21862235-21862257 CCTCCTGCTGGACTTTGCTCAGG + Intergenic
1038337448 8:26656750-26656772 CCCATTCCTGCACTTGGCCAGGG - Exonic
1039469234 8:37803281-37803303 CCCCTCTCTGGACTTTGCTGAGG - Intronic
1043794312 8:84516656-84516678 CACCTTTCTCCACTTTGCTGGGG + Intronic
1044469642 8:92551378-92551400 CCCTTCCCTGCACTGAGCTCAGG + Intergenic
1044511866 8:93090843-93090865 CCCTTTCCTCCAATTTGCTCAGG - Intergenic
1045810955 8:106219439-106219461 CCCCTTCTTTCAGTTTGCTTTGG + Intergenic
1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG + Intronic
1048985079 8:139730830-139730852 CCCCTTCCTACACTGTTCCCTGG - Exonic
1049096254 8:140550037-140550059 CCCCTTCCTTCACTTTGGCCTGG - Intronic
1050704556 9:8382430-8382452 CCCATTCCAGCTCTTTACTCAGG + Intronic
1050924126 9:11241642-11241664 CCCCTTCCTGAATTCTGCTGGGG - Intergenic
1053348322 9:37394555-37394577 CACCTTCATGCATTTGGCTCTGG + Intergenic
1055664724 9:78542066-78542088 CACCTTCCTGCACTGTGCACTGG - Intergenic
1056650112 9:88451960-88451982 CCCCCTCCTGCAATTTGAACAGG + Intronic
1056812646 9:89776421-89776443 CCCTTTCCTGCACATTGTGCCGG - Intergenic
1056819011 9:89823927-89823949 CCCCCTCCTGCCTTTTGCTCAGG + Intergenic
1056829258 9:89901317-89901339 CCACTTCCTCCACTTTCCTCTGG - Intergenic
1056969048 9:91187442-91187464 TCCCTTCCTGCACCTTCCTAGGG - Intergenic
1057024240 9:91723757-91723779 CTGCTTCCTGCACGGTGCTCTGG + Exonic
1059560940 9:115333864-115333886 CCCATTCCTGGACTGTGCCCAGG + Intronic
1060543776 9:124448779-124448801 CTCCTTCCTGCACTTCTCACTGG + Intergenic
1060723686 9:125994204-125994226 CTCCATCCTGCTCTTAGCTCTGG + Intergenic
1061200936 9:129138175-129138197 CCCACTCCAGCACTTTGCTCGGG - Intronic
1061491135 9:130944851-130944873 TCCCTTCCTGGACTTTGGTGTGG - Intergenic
1187572423 X:20518646-20518668 CCCCCGGCTGCACTTTGTTCAGG + Intergenic
1194998134 X:100613939-100613961 CCCCCTCTTGCAAATTGCTCTGG - Intergenic
1195281283 X:103336469-103336491 CCCATTACTGCACTTTTCTGTGG - Intergenic
1196191886 X:112803362-112803384 CCCCATCCTGTAATTTTCTCTGG + Intronic
1196390578 X:115203696-115203718 CCCCTTCCATCAGTGTGCTCTGG - Intronic
1196897549 X:120352600-120352622 TTGCTTCCTGCACTGTGCTCAGG + Intergenic
1196939325 X:120760094-120760116 CCTCTTCCTGTCCTATGCTCAGG - Intergenic
1197772493 X:130098107-130098129 CCCCTGCCTGCCCATGGCTCAGG - Intronic
1199603378 X:149556872-149556894 CCCCTTCCATCACTGTGCCCTGG + Intergenic
1199647009 X:149922603-149922625 CCCCTTCCATCACTGTGCCCTGG - Intergenic