ID: 997962768

View in Genome Browser
Species Human (GRCh38)
Location 5:138335207-138335229
Sequence TCTGCCCTGCAGAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997962768_997962778 23 Left 997962768 5:138335207-138335229 CCAGCCAGCCTCTGCAGGGCAGA 0: 1
1: 0
2: 5
3: 51
4: 412
Right 997962778 5:138335253-138335275 TTCCTGGTTCTTTTTATGACTGG 0: 1
1: 0
2: 11
3: 76
4: 428
997962768_997962777 7 Left 997962768 5:138335207-138335229 CCAGCCAGCCTCTGCAGGGCAGA 0: 1
1: 0
2: 5
3: 51
4: 412
Right 997962777 5:138335237-138335259 AGGGGTGTGTTTTCTATTCCTGG No data
997962768_997962780 27 Left 997962768 5:138335207-138335229 CCAGCCAGCCTCTGCAGGGCAGA 0: 1
1: 0
2: 5
3: 51
4: 412
Right 997962780 5:138335257-138335279 TGGTTCTTTTTATGACTGGTAGG 0: 1
1: 0
2: 0
3: 16
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997962768 Original CRISPR TCTGCCCTGCAGAGGCTGGC TGG (reversed) Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900545278 1:3225423-3225445 CCTGCCCTTCAGAGGCCGACGGG - Intronic
900660119 1:3777966-3777988 CCTCCCCTGCTGGGGCTGGCAGG - Intergenic
901756368 1:11443903-11443925 GCTGCCCTGCCCAGGCTGGTTGG - Intergenic
901872490 1:12146125-12146147 TCTGAGCTGCAGAGAATGGCAGG - Intergenic
903850363 1:26302014-26302036 TCTGCTCTGCAAAGGCTGTGAGG + Intronic
904673750 1:32184762-32184784 ACAGCCCTGAAGAGGCTGGCTGG - Intronic
904755329 1:32765715-32765737 TCTGCTCTGGAGAGGCAGGGTGG + Intronic
906697995 1:47837608-47837630 TCCGCCCTGCAGAGGCCTGATGG - Intronic
906903625 1:49864994-49865016 TCTGGCCTGAAGAGGCAGTCTGG - Intronic
907114728 1:51958793-51958815 TCTGCCCCTCAGTGGCTGGGAGG - Intronic
907813777 1:57898249-57898271 TCTGCCAGACAGAGGCTGACTGG + Intronic
909595835 1:77405480-77405502 TCAACCTTGAAGAGGCTGGCTGG - Intronic
910294029 1:85626877-85626899 TCTGCCCTGGTGAGGCTGGAAGG + Intergenic
915549287 1:156623455-156623477 TGTGCCCTGCAGACGGTGCCGGG + Exonic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
919759982 1:201091787-201091809 GCAGGCCTGCAGAGGCAGGCAGG + Exonic
919796525 1:201324552-201324574 TCTGTGCAGCAGAGGGTGGCGGG - Exonic
920032291 1:203044699-203044721 TCTGCCCTGCAGCAGGGGGCAGG + Intronic
922100721 1:222475275-222475297 TTGGGCCTGCAGAGGCTGCCAGG + Intergenic
922733903 1:227969400-227969422 TTGGGCCTGCAGAGGCTGCCAGG - Intergenic
922966372 1:229694337-229694359 TCTGACCTCCAGGGGCTGGGCGG - Intergenic
923903262 1:238353445-238353467 TTTGCTGTGCAGAAGCTGGCTGG + Intergenic
924412333 1:243819383-243819405 TCTGGCCTGAAGAGGCAGTCTGG - Intronic
924719956 1:246613353-246613375 TTTGTCTTGCTGAGGCTGGCAGG - Intronic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1065289472 10:24215275-24215297 TGGGCTCTGCAGAGGCTGGGAGG + Intronic
1065805365 10:29389123-29389145 TCTGCCCATTAGATGCTGGCAGG - Intergenic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067060225 10:43074626-43074648 ACTGCCCTGCTGAGGGTCGCGGG - Intergenic
1067098366 10:43317072-43317094 TCTGGCCTGCAGAGGCTCCCAGG - Intergenic
1067662676 10:48248064-48248086 TCTGCCTTTCAGAGCCTGGAGGG + Intronic
1069632874 10:69908088-69908110 CCTGCCCTCCAGACCCTGGCTGG + Intronic
1069825773 10:71254223-71254245 TGTGCCCTACTGGGGCTGGCGGG + Intronic
1073318737 10:102600887-102600909 GCTGCCCTGAAGTAGCTGGCTGG + Intronic
1073319230 10:102604194-102604216 TCAGCCCTGCAGAGTCTGGCTGG - Intronic
1075112073 10:119596141-119596163 TCTGCACGGCTGAGGCTGTCAGG - Intronic
1075938822 10:126370562-126370584 TCTGACCTGCAAGGACTGGCAGG - Intronic
1076052399 10:127346221-127346243 GCTGCCCTGCTGGGGCTTGCGGG - Intronic
1076162517 10:128256187-128256209 TCTGCCCTGCAGAGAATGCCAGG + Intergenic
1076836731 10:133024922-133024944 TCAGCTCTGGAGATGCTGGCAGG + Intergenic
1076980220 11:200125-200147 TCTGCCCTGCAGGGCCAGGCTGG - Exonic
1077016339 11:400601-400623 TCCGCGCTGCAGCGGCTGGAGGG + Exonic
1077141500 11:1026827-1026849 TCTGCCCTGCAGCGGGTGCCTGG - Intronic
1077229005 11:1450405-1450427 GGTGCCCTGCAGAGGCTTGTCGG - Intronic
1077239892 11:1505049-1505071 TCTGCCCTGCAGCGGCCTGTTGG - Intergenic
1077539519 11:3139947-3139969 TCTTCCCTGCAGCTCCTGGCAGG + Intronic
1079180557 11:18189748-18189770 TGTCCCCTGCAGACTCTGGCAGG - Intronic
1079385571 11:19976448-19976470 TTTTCCCTGGCGAGGCTGGCAGG + Intronic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1081715734 11:45248789-45248811 AAAGCCCTGCAGAGGCTGACAGG - Intronic
1083254186 11:61486297-61486319 TCAGCCCCGCAGAGGCAGCCTGG - Intronic
1083611106 11:64004745-64004767 TCTGGCCTCCAGAGACTGGTGGG + Intronic
1083904984 11:65663310-65663332 TCTGCTCCGCAGAGGCCGGGTGG + Intergenic
1084014175 11:66369016-66369038 GAAGCCCTGCATAGGCTGGCTGG + Intronic
1084527915 11:69708830-69708852 TCTCCCCTGCATGGTCTGGCAGG - Intergenic
1084556520 11:69879291-69879313 GCTGCCCTGTGGAGACTGGCTGG + Intergenic
1085281373 11:75333258-75333280 TCTGCCCTGCAGAGCTTGAATGG - Intronic
1085311801 11:75521191-75521213 TAGGCCGTGCACAGGCTGGCTGG - Intronic
1085386334 11:76160336-76160358 TCAGCACTGCAGGGGGTGGCTGG + Intergenic
1085527617 11:77173430-77173452 TGTGCCCAGCATAGGCTGGATGG + Intronic
1088186385 11:107176309-107176331 TCTGGCCTGCAGTGGCAGCCTGG + Intergenic
1089363720 11:117908495-117908517 TCTGCCCTGCAGAAGCTTTGGGG + Intronic
1089376697 11:117999773-117999795 CCAGCCCTGCAGGGCCTGGCTGG - Exonic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1089949754 11:122514695-122514717 TCTGCCGTGGAGAGGATGGATGG + Intergenic
1090596789 11:128329144-128329166 TCTGTCCTGCAGAGAATGGCAGG - Intergenic
1090858863 11:130635188-130635210 GCTTCCCTGCAGAGTCAGGCAGG + Intergenic
1090880935 11:130830903-130830925 TCTGGCCTGCAGAGCCTGAAGGG - Intergenic
1091769406 12:3141398-3141420 CGTGCGCTGCAGAGGCCGGCCGG - Intronic
1092238057 12:6822005-6822027 TCTGCCCTGGAGAACCTGGAGGG + Intronic
1092482941 12:8876975-8876997 TTTGCCCTGCAGTAGCGGGCTGG - Intronic
1093502500 12:19828331-19828353 TCTGCCCTGGAGTGGGTGCCAGG + Intergenic
1093541990 12:20298578-20298600 GCTGCGCTGGAGAGGCTGGGTGG + Intergenic
1094608190 12:31967639-31967661 TCCCCCCTGCGGAGGCAGGCTGG - Intronic
1095322401 12:40845646-40845668 TCTCATCTCCAGAGGCTGGCGGG - Intronic
1095584486 12:43835758-43835780 GCCGCTCTGCAGAGGCGGGCCGG + Intergenic
1096743700 12:53712328-53712350 TCTGCACTGCAGAGACCAGCAGG - Intronic
1098014315 12:66088342-66088364 TCTGCCCTGCAGAAGCCAGGAGG + Intergenic
1100389743 12:94138057-94138079 TTTGCTCTGCTGTGGCTGGCTGG + Intergenic
1101013747 12:100477792-100477814 TCTGCCCTGCAAATTCTGGATGG - Intronic
1101124181 12:101614155-101614177 TATCCCCTCCAGAGGCAGGCCGG - Intronic
1102049491 12:109852410-109852432 TGTCCCCTGCAGACTCTGGCAGG + Exonic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1103456579 12:121071654-121071676 TGCTCCCTGCAGTGGCTGGCAGG - Intergenic
1103920427 12:124396596-124396618 CCTGACCTGCAGCGGCAGGCAGG + Intronic
1103958560 12:124593323-124593345 TCTGCCCTGCAGTGGTTGCCTGG + Intergenic
1104652144 12:130543100-130543122 TCTGCCCTAATGAGGCTGTCAGG + Intronic
1104962022 12:132492799-132492821 TCTGCCCTTCGGAGCCTGCCTGG + Intronic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1106120084 13:26852835-26852857 TCTGCGCTGAAGAGTCTGGAAGG + Intergenic
1106128919 13:26923188-26923210 TTTGCCCCGCAAAGGCAGGCAGG - Intergenic
1107031510 13:35858569-35858591 TCAGCCCTGCAGATGCTAGGAGG - Intronic
1107985594 13:45773575-45773597 TCTGCACAGCAGAAGATGGCAGG + Intergenic
1108684191 13:52804663-52804685 TCTGCCCTGGGAAGGCTGGGAGG - Intergenic
1111572743 13:90108172-90108194 TAGGCCCTGCAGAGGCTATCTGG - Intergenic
1112041278 13:95551146-95551168 GCAGCCGTGCAGCGGCTGGCAGG - Intronic
1112247312 13:97746876-97746898 TCTGCCCAGCCCAGGCTGACAGG + Intergenic
1113483644 13:110639269-110639291 TCTGCCCTGCTGGGGCCGGTGGG - Exonic
1113603701 13:111589670-111589692 AATACCCTGCAGAGGCTGGCAGG + Intronic
1115747373 14:36451421-36451443 TCTGCCCAGAAGAGGTAGGCAGG - Intergenic
1116685700 14:48035862-48035884 TCTGTCCTGAAGAGGCAGTCTGG + Intergenic
1119487695 14:75002659-75002681 TCAGGCCTGTAGAGGGTGGCTGG - Intergenic
1120277568 14:82396727-82396749 TTTGCCCTGCTGTGGCTGCCTGG - Intergenic
1121124578 14:91397829-91397851 GCTGTCCTGTAAAGGCTGGCAGG - Intronic
1121404650 14:93712433-93712455 ACTGCCCTGCAGGGCCAGGCAGG - Intergenic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1122134420 14:99624674-99624696 GGTGGCCTGCAGAGGCTGCCCGG - Intergenic
1122236633 14:100334116-100334138 TCTGTCCTGCAGAGTCAGGGTGG - Exonic
1122479733 14:102039264-102039286 TTGGCCATGCAGAGACTGGCGGG + Intronic
1122717075 14:103702243-103702265 GCTTCCCTGCAGACACTGGCTGG - Intronic
1122722427 14:103729830-103729852 GCTGACCTTCAGAGGCAGGCTGG - Exonic
1122786964 14:104168364-104168386 GCTGCCCTGGAGAGGTTGGAGGG - Intronic
1122792463 14:104190089-104190111 TCTGCCCAGCAAAGGTTGGGTGG + Intergenic
1122882899 14:104697972-104697994 TGGGCCCTGCAGAGCCTGGATGG + Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124128966 15:26968154-26968176 TCAGCCCTGGAGAAGCGGGCGGG - Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1125593390 15:40869693-40869715 TGAGCCCTGGAGAGGCTGGGAGG - Intergenic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1126335514 15:47582770-47582792 GCTGCCCTTGAGAGGCTGGCAGG - Intronic
1126593720 15:50365329-50365351 TCTGCCCTTCAAAAGCTGGTAGG - Intergenic
1129523121 15:76198221-76198243 TGTGCCCTGCAGAGCCGGGTTGG + Intronic
1129606226 15:77026333-77026355 GGTGCCCTGCACAGGGTGGCAGG + Intronic
1129786089 15:78311125-78311147 TGTCCCCTCCAGAGGCTGCCAGG + Intergenic
1131265968 15:90915625-90915647 TCTGACCTGCTGGGGCTGTCTGG + Intronic
1132316161 15:100891919-100891941 CCTGCACTGCAGAGCCCGGCCGG - Intronic
1132331469 15:101015052-101015074 GCTGGTCTCCAGAGGCTGGCTGG - Intronic
1132728325 16:1348384-1348406 TCTGCGCTGAGGAGGCTGGAAGG + Exonic
1133155125 16:3868932-3868954 TCTGCCCTGCGGGGGTTGGTCGG - Intronic
1134209951 16:12267769-12267791 TATGCAGTGCAGAGGCTGGGAGG - Intronic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134315360 16:13113880-13113902 TCTGCCCTGAGCTGGCTGGCAGG + Intronic
1136110607 16:28062261-28062283 TCTACCCTCCAGAGGCAGCCTGG - Intronic
1136532981 16:30882350-30882372 TCTGCCCTCCTGGGGCTTGCAGG + Intronic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1137441855 16:48504763-48504785 CCTGCCCTGCGGAAGCTGGTGGG + Intergenic
1137931217 16:52589270-52589292 CCTGCCCTCCAGAGAGTGGCTGG - Intergenic
1138125805 16:54437592-54437614 GCTGCGCTGCAGAGGCTGTGGGG + Intergenic
1138539402 16:57679330-57679352 TCTGCCCTGCAGTGGCTGCCAGG - Intronic
1138558670 16:57787423-57787445 TCACCCCTGCAGGGGCTCGCCGG + Intronic
1139407079 16:66727613-66727635 TGAGCCCTGCAGGGGCTGGGTGG - Intronic
1139916475 16:70431317-70431339 GCTGACCTGCTGAGGCTGGGGGG + Intronic
1139950409 16:70665540-70665562 TCTGCCATGCAGAGGCCAGCAGG + Exonic
1141684939 16:85564813-85564835 TCTGGCCTGCAGAGCCTGGGAGG - Intergenic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1141832112 16:86515692-86515714 TCTGGCCTGCAGAGGCTGACCGG - Intergenic
1141887986 16:86905958-86905980 TCTGCCTAGCAGACACTGGCTGG - Intergenic
1142172057 16:88628055-88628077 TGTGCCCTGCTGGGGCTGCCCGG - Exonic
1143038771 17:4016940-4016962 GCAGCCCTGCAGGTGCTGGCAGG - Intronic
1144600506 17:16608606-16608628 TGTGGCCTGCAGTGGCTGTCAGG - Intergenic
1145269862 17:21399080-21399102 CAAGCCCTGCAGATGCTGGCAGG + Intronic
1145751984 17:27361698-27361720 TGTGCACTGATGAGGCTGGCAGG - Intergenic
1145932385 17:28695206-28695228 TCTGCCATTCAGCAGCTGGCTGG + Intronic
1146495085 17:33314543-33314565 TCTGCCCTTCTGGGGATGGCTGG + Intronic
1146771942 17:35577128-35577150 TCACCACTGCTGAGGCTGGCTGG - Exonic
1147328957 17:39685141-39685163 TCTGGCCTGTTGAGGTTGGCAGG - Intronic
1147342882 17:39765339-39765361 TCTGCCCTTCACAGGCTGAAGGG - Exonic
1147635398 17:41960871-41960893 CCTGCCCTCCAGAGGCTCACAGG + Intronic
1148756517 17:49975939-49975961 TCTGGCCTGCAGCGGTTGGCTGG - Intergenic
1149549880 17:57532309-57532331 TCTTCCCTGCTGAGGCTTCCTGG - Intronic
1150249429 17:63698007-63698029 CTTGCCCTGCAGAGGCAGGGTGG + Exonic
1150304204 17:64070589-64070611 TGGGCCCTGCAGAAGCTGGCCGG - Intronic
1150410074 17:64935217-64935239 TCTGCCCTCCTGAGGGTGCCAGG + Intergenic
1150768362 17:68020406-68020428 CCTGCCCTGCAGAGGGTCCCGGG - Intergenic
1151340030 17:73465292-73465314 TCTGCCCTGCTGTGGGTGGGTGG + Intronic
1151346776 17:73507237-73507259 TGATCCCTGCAGAGGATGGCTGG - Intronic
1151542390 17:74771214-74771236 CTTGTCCTGCAGAGGCAGGCTGG - Exonic
1151599886 17:75099794-75099816 TCTGCCCTCCCAAGGCTGCCAGG - Intronic
1151699259 17:75734032-75734054 TCAGCCCTCCAATGGCTGGCAGG + Intronic
1151990322 17:77570409-77570431 CCTGCCCTGCAAAGGCTGTGTGG + Intergenic
1152149908 17:78592571-78592593 TCCGCGCTGCAGAGACTAGCTGG + Intergenic
1152334630 17:79693451-79693473 TCTGCACAGCAGATGCTGTCCGG + Intergenic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1153794487 18:8609740-8609762 GCCGCGCTGCAGAGGCGGGCCGG + Exonic
1154136451 18:11784073-11784095 TCTGCCCTGCATGGGCTTGCTGG - Intronic
1154350614 18:13580258-13580280 GCTGCTCTGGAGAGGCTGCCTGG + Intronic
1155537681 18:26833690-26833712 TCTCCCCAGGAGAGGCTGGCTGG + Intergenic
1156861364 18:41839997-41840019 TCTTCCCTGCTGAGGCTGTCAGG - Intergenic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157346541 18:46841058-46841080 TCTGTCCTGCAGAGGTGGACTGG - Intronic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1160222411 18:76986709-76986731 TCTGCCATGTAGAGCCAGGCTGG - Intronic
1160980722 19:1815476-1815498 TCTGTGCTCCAGGGGCTGGCCGG - Exonic
1161043472 19:2122168-2122190 TCTTCCCTGCACTGGCTGGGTGG - Intronic
1161270801 19:3388206-3388228 GGTGCCCTGGAGAGGGTGGCAGG + Intronic
1161383161 19:3977176-3977198 TGTGGCCTGCAGAGCCTGGCAGG - Intronic
1161776231 19:6263738-6263760 TCTGCCTTTCAGAAACTGGCAGG - Intronic
1161778135 19:6274948-6274970 GCTGCCCTCGAGAGGCTGCCTGG - Intronic
1162224085 19:9205200-9205222 AGTGCCCTGCAGAGGCTGCACGG + Intergenic
1162531388 19:11238181-11238203 ACTGACCGGCAGAGCCTGGCTGG + Exonic
1162577269 19:11506258-11506280 CCAGCCCTGCAGAGGATGTCTGG + Exonic
1163795592 19:19336022-19336044 TGTGCCCTGCAGACCTTGGCAGG + Intronic
1165046641 19:33109858-33109880 TCTCCCCTGCAGCGGCTGCTGGG + Exonic
1165075996 19:33280215-33280237 TCAGCCCTGCTCAGGCTGGCAGG + Intergenic
1165088455 19:33368324-33368346 GCTGCTCTGGAGAGGTTGGCAGG - Intergenic
1166283496 19:41810080-41810102 TCTGCCTGGCAGTGACTGGCAGG - Intronic
1166301159 19:41912927-41912949 CCGGCCCTGCAGAGGCCGGGAGG + Intronic
1167609913 19:50502039-50502061 AGGGCTCTGCAGAGGCTGGCGGG - Intergenic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
1168323066 19:55521775-55521797 TCTGGCCTGCAGAGAGGGGCTGG - Intergenic
1168688542 19:58362955-58362977 TGTGTGCCGCAGAGGCTGGCCGG - Intergenic
925150167 2:1610231-1610253 GCTGCACTGCAGGGGCCGGCGGG - Intergenic
925409103 2:3628548-3628570 GCTGCCCTGAACAGGCTGGCTGG + Intronic
925897893 2:8487487-8487509 TCTGCCCTCCAGGGGCTGCCAGG + Intergenic
925982085 2:9185076-9185098 TCTGCCCTTCAGTAGCTGGGGGG + Intergenic
926204825 2:10828604-10828626 CCTGCCCCGCACAGGCTAGCAGG - Intronic
926668078 2:15546895-15546917 TCAGCCCTCCAGTGGCTGGGTGG - Intronic
927490171 2:23516145-23516167 TCTGCCCTGCCCAGCCTGGCTGG + Intronic
927518409 2:23685416-23685438 TCTGCCCCGGAGAGGCTGCAAGG - Intronic
929547717 2:42866566-42866588 GCTGCCCTGCAAGGGCTGCCAGG + Intergenic
930567521 2:53041247-53041269 TCTGCTCTGCAGAGGCTGTTTGG + Intergenic
930843638 2:55876880-55876902 TTTGCCCTGCAGAAGCTCACTGG + Intronic
931228080 2:60351328-60351350 TCTGCACAGCTGAGGCTGGAAGG - Intergenic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
933757194 2:85649049-85649071 TCTGCCCTGCTGAAGCTAGATGG - Exonic
933984705 2:87580962-87580984 ACTGTCCTGCAGAGGCTAGCAGG - Intergenic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
934109079 2:88725116-88725138 TCTGGCCAGAAGAGGCAGGCAGG + Intronic
934613361 2:95756456-95756478 TCTGCTCCTCAGTGGCTGGCAGG + Intergenic
934647536 2:96067964-96067986 TCTGCTCCTCAGTGGCTGGCAGG - Intergenic
934677271 2:96258451-96258473 TTCGCCCAGCAGAGGCTGGCTGG + Intronic
934770941 2:96907338-96907360 TGTGCCCTGCACAGTCTGGGTGG - Intronic
934840910 2:97623784-97623806 TCTGCTCCTCAGTGGCTGGCAGG - Intergenic
935058760 2:99590315-99590337 CCTGCCCTGCAGAAACAGGCAGG + Intronic
936309146 2:111369838-111369860 ACTCTCCTGCAGAGGCTAGCAGG + Intergenic
937903744 2:127041627-127041649 TGTGACCTGCAGGGGGTGGCTGG - Intergenic
937910477 2:127073259-127073281 GCTGCCCTGCGGAGGGTAGCTGG - Intronic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
941183329 2:162288260-162288282 TCTTCCCTTCCAAGGCTGGCTGG + Exonic
941568010 2:167132624-167132646 GATGGCCTGCAGAGGCAGGCCGG - Intronic
941770664 2:169342015-169342037 TCTGCCCTCTAAATGCTGGCAGG + Intronic
942140434 2:172972141-172972163 GCTGTCCTGCAGAGGCTGGGTGG + Intronic
942222487 2:173784200-173784222 GCGGCCCTGTAGAGGCTGGGGGG + Intergenic
946389265 2:219405581-219405603 TCTGTCCTGGAGAGGCTGCCAGG - Intergenic
946445620 2:219737635-219737657 CATGCCCTGCAGAAGTTGGCTGG + Intergenic
947744541 2:232500808-232500830 ACTGCCCTGGAGCAGCTGGCTGG - Intergenic
947795000 2:232889079-232889101 GCTGCCAGGCAGAGGCGGGCAGG - Intronic
948295702 2:236858767-236858789 GCTGCCCTGGAGATGTTGGCTGG + Intergenic
948514180 2:238493152-238493174 TCTTCCCTGCAGCGTTTGGCTGG + Intergenic
948598192 2:239093796-239093818 TCTGCCTTGCACAGGCGTGCTGG + Intronic
948863988 2:240766250-240766272 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
1168810124 20:699703-699725 CCTGCCCTCCAGGGACTGGCAGG - Intergenic
1168851723 20:981642-981664 TCTGCCATGCTGGGCCTGGCAGG - Intronic
1168854965 20:1002037-1002059 TCTGCCCCGCAGCGCCTGCCCGG + Intronic
1168986416 20:2052858-2052880 TCTGCCTTGCAGATGAGGGCTGG - Intergenic
1169049596 20:2564711-2564733 TCTGCCCCTCAGAGGCAGGAAGG - Intronic
1169514782 20:6303877-6303899 TCTGAACTGCAGGGGCTGCCTGG - Intergenic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172610120 20:36244552-36244574 TCACTCCTGCAGAGCCTGGCAGG - Intronic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1175266559 20:57706924-57706946 TCTCCCCTGCTGAGCCTGGCTGG - Intronic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175771860 20:61629054-61629076 TCTGATCTGCACAGGCAGGCAGG + Intronic
1176415424 21:6471876-6471898 CCAGCCCTGCAGAGCCCGGCAGG + Intergenic
1177388103 21:20433329-20433351 TCTGGCCTGAAGAGGCAGTCAGG - Intergenic
1179165388 21:38931645-38931667 TCTGCTTTGCAGCGGCAGGCAGG - Intergenic
1179690924 21:43080209-43080231 CCAGCCCTGCAGAGCCCGGCAGG + Intergenic
1180098888 21:45575074-45575096 TCTCCCCTGGAGTGCCTGGCTGG + Intergenic
1180155963 21:45977573-45977595 GCTGCACTGCAGGGTCTGGCTGG - Intergenic
1181127434 22:20710293-20710315 ACTGCCCTGCAGAGAAAGGCAGG - Intronic
1181462443 22:23093805-23093827 TCTGGCTGTCAGAGGCTGGCAGG + Intronic
1181864039 22:25841194-25841216 TGTGACCTGCAGAGGCTGAGGGG + Intronic
1182517544 22:30867551-30867573 TCTGTTCTGCAGAGACAGGCAGG - Intronic
1183308477 22:37096740-37096762 TCTGCCCTGCAGAGGGTCCCAGG - Intronic
1183395535 22:37568930-37568952 TCTGTCCTGCAGAGGTGGGGAGG - Exonic
1183510625 22:38232662-38232684 TCTGTACTGCAGGGGCTGGCGGG - Intronic
1183539283 22:38420178-38420200 TTTGGCCTTCAGAAGCTGGCAGG - Intergenic
1183726010 22:39590091-39590113 GCTGCCCTGCAGGGCCTGCCCGG + Intronic
1183742425 22:39676180-39676202 TGTGCCCTGCACAGGCCGGCGGG - Intronic
1183808860 22:40237314-40237336 TCTGCCCTGAAGGTGCTGTCTGG + Intronic
1184298955 22:43543678-43543700 GCTGCCCTGGAGGGGCTGGATGG + Intronic
1184563300 22:45275885-45275907 GCAGCCCTCCAGAGACTGGCAGG + Intergenic
1184965783 22:47971088-47971110 TGTCCCCTGCAGAGGCTGAAGGG + Intergenic
1185315921 22:50179056-50179078 TCCGCCTTGCCCAGGCTGGCTGG - Exonic
949145225 3:691392-691414 ACTGCACTGCAGAGTGTGGCTGG + Intergenic
950070880 3:10151534-10151556 TCTGCCCTAAAAAGGCTGGAAGG - Exonic
950125984 3:10510087-10510109 TCAGCCCTGCAGATGCTATCTGG - Intronic
950199014 3:11029509-11029531 CCTGCCCTCCAGAGGCTCCCAGG + Intronic
950493912 3:13322401-13322423 CCAGGCCTGCACAGGCTGGCTGG + Intronic
952735615 3:36689098-36689120 TCTGCCCTTCAGTTGCTTGCTGG - Intergenic
954196667 3:49001248-49001270 GTTGTCCTGCAAAGGCTGGCTGG - Intronic
954750659 3:52811640-52811662 CCTGCCCCGCAGGTGCTGGCAGG + Intergenic
954756022 3:52840440-52840462 TCTGCACACCAGCGGCTGGCGGG + Exonic
955419705 3:58724157-58724179 TTTTCCCTGCTGGGGCTGGCTGG + Intronic
957024044 3:75159456-75159478 TCTGCCAGGCTGAGGCGGGCAGG - Intergenic
959027656 3:101259175-101259197 GATGTCCTGCAGAGACTGGCTGG - Intronic
960140268 3:114145119-114145141 TCAGCCCAGCAGATGTTGGCAGG + Intronic
961037611 3:123653453-123653475 ACTCCCCAGCTGAGGCTGGCTGG - Intronic
961422198 3:126815328-126815350 TCTGGCATACAGAGGATGGCTGG - Intronic
961523229 3:127480322-127480344 TATGCCATTCAGAGGTTGGCTGG - Intergenic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
962234150 3:133693474-133693496 TCAACACTGCAGAGGTTGGCCGG - Intergenic
962632681 3:137295573-137295595 ACTGCCCTGCTGAGGAAGGCTGG - Intergenic
963531383 3:146476745-146476767 TCTGCCCTAAAGAGGCAGTCTGG - Intronic
964719818 3:159760290-159760312 TCTGCCCTGCAGAGGCTCCTTGG - Intronic
966121607 3:176527933-176527955 CCTGCCCTGCTGAGGCTGTCTGG + Intergenic
966860089 3:184226670-184226692 TCTGCCCTCCAAAGGCCGACAGG + Intronic
966971243 3:185047485-185047507 TCTGCACTGCACAGGTTGGTGGG - Intronic
967809432 3:193744524-193744546 TCCTTCCTGCAGAGGCTTGCAGG + Intergenic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
968573199 4:1353247-1353269 GGTGGCCTGCAGAGGCAGGCAGG - Exonic
969451734 4:7277714-7277736 TGGGCCCTCCAGAGGCTGACTGG - Intronic
969566487 4:7981841-7981863 ACTGCCCTGCACTAGCTGGCTGG - Intronic
969861080 4:10035689-10035711 TCTGCCCTCCAGTGGGGGGCAGG + Intronic
970779689 4:19721586-19721608 CCTTCACTCCAGAGGCTGGCTGG + Intergenic
973856297 4:55013684-55013706 TCTGGCCTGAAGAAGCTGGATGG + Intergenic
979259070 4:118632300-118632322 TTGGGCCTGCAGAGGCTGCCAGG - Intergenic
979940749 4:126759049-126759071 TCTGTCATGCAGATGCTGTCGGG + Intergenic
980413752 4:132458325-132458347 CCTACCCTACAGAGGCAGGCAGG - Intergenic
981076255 4:140595371-140595393 CCAGCCCTGCTGAGGGTGGCTGG + Intergenic
983323725 4:166227237-166227259 TCTGCCCTGAAGTGGGTGCCAGG - Intergenic
984784089 4:183552400-183552422 TCTGCCCTGCAGCGGAGGGTCGG + Intergenic
984811568 4:183799913-183799935 TCAGTACTACAGAGGCTGGCAGG - Intergenic
984858656 4:184217747-184217769 TCCGGCGGGCAGAGGCTGGCTGG + Exonic
985383367 4:189419384-189419406 TGTGCCCGGCAGAGCCTGGGTGG + Intergenic
985548304 5:520837-520859 TGTGCCTTGCAGAGACTGCCAGG - Intronic
985560247 5:582120-582142 TCTGCCCAGCAGATGCAGCCAGG + Intergenic
985964469 5:3329531-3329553 GCCACTCTGCAGAGGCTGGCAGG + Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986084192 5:4426719-4426741 TCTGCCCTGCAGAGGGTGATTGG + Intergenic
986366551 5:7038558-7038580 TCTGCCATGAAGAGCCTGTCAGG - Intergenic
988721120 5:33880082-33880104 TTTGCCCTGCAGTTGCTGGTGGG + Intronic
992000855 5:72434899-72434921 GCTGGCCTGCTGAGGCTGGCAGG - Intergenic
992023508 5:72648721-72648743 ACTGAACTGCAGAGGCTGGCTGG + Intergenic
992444323 5:76820093-76820115 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
992956156 5:81910664-81910686 ACTTCCCTGCAGAGAGTGGCAGG - Intergenic
994140305 5:96334220-96334242 TCTGCTCTCCAGAGGCAGTCAGG + Intergenic
994425002 5:99574100-99574122 ACTGCCCTGCTGATGCTGTCCGG - Intergenic
996406709 5:123112315-123112337 ACTGCACTGAAGGGGCTGGCAGG - Intronic
997198903 5:131997904-131997926 TCTGCCTTGCAGTGGCTCCCAGG - Intronic
997267371 5:132502681-132502703 GCTGCCATGCTGAGGCTGGTGGG + Intergenic
997430411 5:133835184-133835206 GCTGCCTTGAAGAGGCAGGCGGG + Intergenic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
997962768 5:138335207-138335229 TCTGCCCTGCAGAGGCTGGCTGG - Intronic
998192779 5:140041948-140041970 CCTGCCGTGCCCAGGCTGGCAGG - Intronic
998252843 5:140564260-140564282 GCGGGCCGGCAGAGGCTGGCGGG - Exonic
999188293 5:149729159-149729181 GCGGGCCTGCGGAGGCTGGCAGG + Intergenic
999763587 5:154721583-154721605 GCTTCCCTGCAGTGGCTGGCAGG - Intronic
1001232557 5:170001196-170001218 TCTGCCCTGCAGAGGAGGGCAGG + Intronic
1001269912 5:170303150-170303172 GTTGCCTTGCACAGGCTGGCCGG - Intergenic
1001454275 5:171848705-171848727 TGTGCCCTCCAGAGCCAGGCAGG + Intergenic
1001544607 5:172563332-172563354 TCTGCCCTGTCAATGCTGGCAGG - Intergenic
1002159999 5:177309417-177309439 TGTGCCCCTCAGGGGCTGGCTGG - Intronic
1002437602 5:179241343-179241365 TGTGCCTCACAGAGGCTGGCTGG - Intronic
1003136901 6:3440989-3441011 TCTCCACTACAGAGGCTGTCAGG - Intronic
1003187894 6:3849146-3849168 CCTGCCCAGCCGTGGCTGGCCGG - Intergenic
1003700850 6:8463037-8463059 TCTGCCCTCCAAAGGCTTGCTGG - Intergenic
1003730808 6:8821475-8821497 AGAGCCTTGCAGAGGCTGGCAGG + Intergenic
1005620627 6:27617035-27617057 ACTGCCCTGCACAGGCTTGTTGG + Intergenic
1006373430 6:33659061-33659083 GCTGGCATGCAGAGGCTGCCCGG - Exonic
1007341268 6:41192764-41192786 TCTGCCCTCAGGAGGCTGGGAGG + Intronic
1007589255 6:43011669-43011691 TCTCCCCTGCAGAGGCATGTAGG + Exonic
1008677938 6:53841225-53841247 TCTACCCTGCAGAGCCAGGCAGG - Intronic
1009452823 6:63821600-63821622 TCAGCACTCCAGAGGCTGTCAGG + Intronic
1010245110 6:73655005-73655027 TCTGCCCTGCCAAGGCAAGCTGG - Intergenic
1011422306 6:87186059-87186081 TCTGCTCTCCAGAGGTTGGGGGG + Intronic
1011747203 6:90418034-90418056 TCAGCCCTGGAGGGGGTGGCGGG - Intergenic
1014293300 6:119586684-119586706 GCGGCCCTGCAGCAGCTGGCAGG + Intergenic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1016402767 6:143698729-143698751 TCTGCCCTTAGGAGGCTTGCAGG - Intronic
1017429755 6:154359426-154359448 TTTGCTGTGCAGAGGCTGGGCGG - Intronic
1017484421 6:154889731-154889753 TCTGCCCTGGGGAGGCAGGCAGG + Intronic
1018180952 6:161223036-161223058 TGCGCCCTGCACAGGATGGCTGG + Intronic
1018199729 6:161383752-161383774 GATGACCTGCAGAGGCGGGCTGG - Intronic
1018236303 6:161727242-161727264 TTTGCCCTGCAGGGGTTGGTTGG - Intronic
1019884789 7:3894406-3894428 AAGGCCCTGCAGAGGCTGTCAGG - Intronic
1019969971 7:4532862-4532884 TCTCTCCTGCAGAGCCTAGCAGG - Intergenic
1021128662 7:16883885-16883907 TTTGCTTTGCAAAGGCTGGCTGG - Intergenic
1022171810 7:27838690-27838712 TCTGCCCCGAAGTTGCTGGCTGG - Intronic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1023401251 7:39793961-39793983 TTGGGCCTGCAGAGGCTGCCGGG - Intergenic
1024075256 7:45814669-45814691 TTAGGCCTGCAGAGGCTGCCGGG - Intergenic
1024648362 7:51386720-51386742 TTGGGCCTGCAGAGGCTGCCGGG + Intergenic
1024648894 7:51388793-51388815 TTGGGCCTGCAGAGGCTGCCGGG + Intergenic
1024649355 7:51390852-51390874 TTGGGCCTGCAGAGGCTGACAGG + Intergenic
1025087349 7:56034173-56034195 TCTGCTCTGCAAAGCCGGGCTGG + Intronic
1025108027 7:56189157-56189179 GCTGCCTTGCAGAAGCTGGCTGG - Intergenic
1025131536 7:56376655-56376677 TTGGGCCTGCAGAGGCTGCCAGG + Intergenic
1025182097 7:56828457-56828479 TTGGGCCTGCAGAGGCTGCCAGG + Intergenic
1025182337 7:56829721-56829743 TTGGGCCTGCAGAGGCTGCCAGG + Intergenic
1025689590 7:63747273-63747295 TTGGGCCTGCAGAGGCTGCCAGG - Intergenic
1025689832 7:63748538-63748560 TTGGGCCTGCAGAGGCTGCCAGG - Intergenic
1025899388 7:65731780-65731802 TCTGCTCTGCAAAGCCGGGCTGG + Intergenic
1026310218 7:69176905-69176927 GCTGCCTTGCAGAAGCTGGCTGG + Intergenic
1026947885 7:74327905-74327927 TCTGCTCAGCAGAGGCGGCCGGG - Intronic
1027027004 7:74860216-74860238 TCTGTCCTGCTCAGGCTGGAGGG + Intergenic
1027052468 7:75028812-75028834 TCTGAGCTGGAGAGGCTTGCAGG + Intronic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1028994622 7:97086148-97086170 CCTGCCCTGGAGAGGCTCTCAGG - Intergenic
1029159921 7:98544296-98544318 TCTGCCCTGCAGCACCTGGGTGG + Intergenic
1029607317 7:101606712-101606734 TCTGCCCTGCAGTGTCTTGGAGG + Intergenic
1031935020 7:127727232-127727254 CCTGCCCTGGAGAGCCAGGCGGG - Intronic
1032320984 7:130886538-130886560 TCTTCTCTGCAGTGGCAGGCTGG - Intergenic
1033587683 7:142786604-142786626 CATGGCCTGCAGAGGATGGCAGG - Intergenic
1033741676 7:144280884-144280906 TCTGCCTTTCAGAGGCAGGGAGG - Intergenic
1033752225 7:144368730-144368752 TCTGCCTTTCAGAGGCAGGGAGG + Intronic
1034984289 7:155497660-155497682 TGGGCCCTGCATAGGCCGGCCGG - Intronic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1036770047 8:11572480-11572502 TGTGGGCTGCAGAGGCTGACAGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039800835 8:40953120-40953142 TTTTCCCTGAAGTGGCTGGCAGG + Intergenic
1040555812 8:48476763-48476785 TTACCCATGCAGAGGCTGGCAGG + Intergenic
1040601675 8:48890816-48890838 TCTGCCCTATAGAAGATGGCTGG + Intergenic
1040841821 8:51792722-51792744 TCTGGCCTGAAGAGGCTGTCTGG - Intronic
1041437557 8:57859196-57859218 CCTGACCTGCAGCTGCTGGCAGG + Intergenic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1042359504 8:67866777-67866799 TCTGCCATCCAGCTGCTGGCAGG + Intergenic
1043122400 8:76343895-76343917 TCTGCCCTGCAGCTGGTGGGAGG - Intergenic
1043855789 8:85263228-85263250 TCTGTCCTGATGAGGCAGGCAGG + Intronic
1044278860 8:90333768-90333790 TGGGGCCTGCAGAGGCAGGCAGG - Intergenic
1044954478 8:97465351-97465373 ACTGTACAGCAGAGGCTGGCTGG + Intergenic
1045738169 8:105319581-105319603 TCTGCCCTGCGGGCGCGGGCTGG + Intronic
1046293635 8:112194504-112194526 TCTTCCCTGCAGCCCCTGGCAGG + Intergenic
1047170911 8:122491387-122491409 TATACCCTGCAGAGGCTGTGGGG + Intergenic
1047314776 8:123722820-123722842 TCTGCCCTTCAAAGGCTGTTAGG + Intronic
1048318891 8:133383234-133383256 TCTGGCCAGCAGAGCCTGGGAGG + Intergenic
1048356124 8:133655216-133655238 TCTGCCCTGCACAGACTGTGTGG - Intergenic
1049024066 8:139976725-139976747 GCAGCCTTGCAGAGTCTGGCAGG + Intronic
1049259168 8:141629581-141629603 ACTGCCACCCAGAGGCTGGCTGG - Intergenic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049472710 8:142783482-142783504 GCAGCCCTGCAGTGGCTGGGAGG + Intergenic
1049624231 8:143612960-143612982 TCACCGCTGCAGAGGCAGGCAGG + Exonic
1050671111 9:7997972-7997994 TCAGCCTTGCAGAGGTTTGCTGG + Intergenic
1050855816 9:10353512-10353534 TCTCCCATGCAGAGGTTGGCAGG - Intronic
1051542708 9:18237987-18238009 TTTGCCCTCTAGAGGCTGGAGGG + Intergenic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1053007420 9:34613282-34613304 CCTGCCCTGCACGGGCTAGCAGG - Intergenic
1053067383 9:35078220-35078242 TCTGCCCTGCACCGCCTGGTTGG - Exonic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054191608 9:61988950-61988972 CCTGCCCTGCAGACCCTGCCTGG + Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1054646763 9:67598762-67598784 CCTGCCCTGCAGACCCTGCCTGG - Intergenic
1056249754 9:84735447-84735469 GATGCCCTGCAGAAGCTGGAGGG + Intronic
1056308816 9:85319535-85319557 TCTGCTCTGCAGTGGCTGTCTGG - Intergenic
1056852158 9:90093801-90093823 CCGGCCCTTCAGGGGCTGGCTGG + Intergenic
1057179781 9:93023465-93023487 TCTGCTCTGCAGAGGCCAGGTGG - Intronic
1057208767 9:93188224-93188246 TCTGCCCTCCACAGGCTGGGGGG + Intronic
1057226095 9:93294022-93294044 TCTGTCCTGCTGCGGCTGGGGGG + Intronic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1059424266 9:114210970-114210992 TCTCCCCTGCAGGGCCTGCCTGG + Exonic
1060512348 9:124243155-124243177 TCTGGCCTGCACCGGCTGGTTGG - Intergenic
1061424055 9:130488360-130488382 CCTGCCCTGCAGCTGCTGTCTGG - Intronic
1061729621 9:132603743-132603765 TCGTCCCGGGAGAGGCTGGCTGG + Intronic
1062383742 9:136299988-136300010 CCTGCCCTGCAGGGCCTGCCTGG + Intronic
1062385609 9:136310335-136310357 CCTGCCCTGCAGACCCGGGCAGG - Intergenic
1062491745 9:136808203-136808225 TCCGCCCTGAAGAAGCTGGTGGG + Exonic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1186517456 X:10176604-10176626 TCTACCCTGCCCACGCTGGCAGG + Intronic
1187001111 X:15179335-15179357 GCTTCCCTGTAAAGGCTGGCTGG - Intergenic
1187456346 X:19444637-19444659 TCTGCTCTGCAGAAGATGCCAGG - Intronic
1192792784 X:74399586-74399608 ACTGCCCTGAAGAGGCGGGGAGG - Intergenic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1193397653 X:81004073-81004095 TCTGCCCTGCAGATACCGGATGG - Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1197939581 X:131775847-131775869 TCTGTCCTGCAGTTGCTTGCTGG + Intergenic
1198688920 X:139259257-139259279 TCTACTCTGCTGAGGCAGGCTGG + Intergenic
1200212886 X:154354701-154354723 TTTGCCCTGCAGGCTCTGGCTGG - Exonic
1201283989 Y:12363614-12363636 TCTGCCCTGTGGGGGCTGGGAGG + Intergenic