ID: 997964846

View in Genome Browser
Species Human (GRCh38)
Location 5:138348726-138348748
Sequence CTAGGCTACCAGGTCTCTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997964835_997964846 14 Left 997964835 5:138348689-138348711 CCTCAGAGGCTCCTCCCTATCTC 0: 1
1: 0
2: 2
3: 31
4: 262
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
997964841_997964846 -8 Left 997964841 5:138348711-138348733 CCTGGCTAGTTACCACTAGGCTA 0: 1
1: 0
2: 0
3: 5
4: 50
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
997964834_997964846 15 Left 997964834 5:138348688-138348710 CCCTCAGAGGCTCCTCCCTATCT 0: 1
1: 0
2: 0
3: 10
4: 230
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
997964838_997964846 0 Left 997964838 5:138348703-138348725 CCCTATCTCCTGGCTAGTTACCA 0: 1
1: 0
2: 1
3: 9
4: 123
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
997964833_997964846 22 Left 997964833 5:138348681-138348703 CCTCTGGCCCTCAGAGGCTCCTC 0: 1
1: 0
2: 4
3: 34
4: 368
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
997964839_997964846 -1 Left 997964839 5:138348704-138348726 CCTATCTCCTGGCTAGTTACCAC 0: 1
1: 0
2: 1
3: 8
4: 114
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
997964837_997964846 3 Left 997964837 5:138348700-138348722 CCTCCCTATCTCCTGGCTAGTTA 0: 1
1: 0
2: 0
3: 3
4: 145
Right 997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997964846 Original CRISPR CTAGGCTACCAGGTCTCTAG GGG Exonic
903265883 1:22157626-22157648 CTAGGCTACCCTGCCTCTGGAGG - Intergenic
907366640 1:53966338-53966360 CTAGGCTCCGAGGTCTCCCGTGG - Exonic
911358453 1:96848980-96849002 CTAGGCTTCCAGGTCTGTGATGG - Intergenic
911799066 1:102110518-102110540 CTAGGCCCCCAGGTCTGTGGTGG + Intergenic
916650498 1:166830581-166830603 CTAGGCTTCCAGGTCTATGATGG - Intergenic
917342095 1:173990309-173990331 CGAGGCTAGCAGATCTCTTGAGG - Intronic
924219435 1:241857341-241857363 CTAGGCTGCCCGGTCTCAGGGGG + Exonic
924601490 1:245493671-245493693 CAAGGCAACCAGGTCTTGAGTGG + Intronic
1065640472 10:27777339-27777361 CTAGGCTCCCAGCTTTCTATAGG + Intergenic
1068287655 10:54961488-54961510 CTAGGCTACCAGTTCTGGAGTGG + Intronic
1068355869 10:55907506-55907528 CTAGGCCACCAGGTCTGTGATGG + Intergenic
1068983872 10:63089247-63089269 CTAGGCTGGCAGATCACTAGAGG - Intergenic
1069070552 10:63987100-63987122 CCAGGCTACAAGTTCTCCAGAGG + Intergenic
1077484293 11:2831771-2831793 CTAGCCTTCCAGGGCTCTGGTGG - Intronic
1085875706 11:80404420-80404442 CTAGGCTTCCAGGTCTGCAAAGG - Intergenic
1086043838 11:82509890-82509912 CTAGGCTAGCAGATCACTTGAGG - Intergenic
1087551534 11:99656690-99656712 CCAGTCTTCCATGTCTCTAGTGG - Intronic
1088738284 11:112746468-112746490 CTTGTCTTCCAGGTCTCTTGGGG - Intergenic
1089169128 11:116500221-116500243 CTGGGCTAGGAGGCCTCTAGAGG - Intergenic
1089891277 11:121883918-121883940 CAAGGCTATCAGGTCAATAGTGG + Intergenic
1089928086 11:122280371-122280393 CTAGGCTTCAAAGTGTCTAGAGG + Intergenic
1096539457 12:52296845-52296867 CTGGGCTTACAGGTCTCCAGAGG - Intronic
1101663619 12:106788784-106788806 CTAGGCTTCCGGGTCTGTAATGG + Intronic
1104427353 12:128688725-128688747 CTAGGCCACCAGGTTTCTTCTGG - Intronic
1110902286 13:80837842-80837864 CTAGGCTTCCAGGTCTGTGATGG + Intergenic
1113636905 13:111925665-111925687 TGAGGCCACCAGGTCTCCAGTGG + Intergenic
1115902291 14:38165507-38165529 CTAAGCTACAATATCTCTAGCGG + Intergenic
1116998258 14:51346792-51346814 CTAGGCTACCAGGCCTGCAGTGG - Intergenic
1117255698 14:53975275-53975297 CATGGCCACCAGGTCTCAAGGGG - Intergenic
1117331724 14:54719157-54719179 CTGGGCTATCAGAACTCTAGAGG + Intronic
1118966103 14:70587098-70587120 CTTGGGTACCAGGTCTCTAATGG + Intronic
1120659072 14:87230946-87230968 CTAGGCCACCAGGTCTGTGATGG + Intergenic
1123028891 14:105441282-105441304 CTTGGCTCCCAGGACCCTAGCGG + Intronic
1129619209 15:77128463-77128485 CTAGCCTACCAGATCTCAAGAGG - Intronic
1135382950 16:22008869-22008891 CTCGCCCACCAGCTCTCTAGTGG - Intronic
1142417434 16:89950068-89950090 CTAGGCTACCAGCTCTCCTCCGG - Intronic
1147423637 17:40334837-40334859 ATAGGCTACTAGGTCTCTGAAGG - Intronic
1148162158 17:45456534-45456556 CTAGGCCATCAGGTTTCTTGAGG - Intronic
1149331215 17:55584124-55584146 CTATGCTACCTGGACTCTTGAGG - Intergenic
1150393392 17:64803182-64803204 CTAGGCCATCAGGTTTCTTGAGG - Intergenic
1151216600 17:72581383-72581405 CTAGGATACCAGGTATACAGAGG + Intergenic
1151617097 17:75220495-75220517 CTTGGCCTCCAGGTCTCCAGTGG + Intronic
1153073499 18:1133716-1133738 CCAGCCTTCCAGGTCTCTATGGG + Intergenic
1161322156 19:3646283-3646305 AAATGCTAACAGGTCTCTAGTGG - Intronic
1161357081 19:3825177-3825199 CTAGGCGGCCAGGGCTCTGGTGG + Intronic
1162768998 19:12937970-12937992 ATAGGCTGCCAGGGCTCTAGGGG + Intergenic
1163576065 19:18111313-18111335 CTTTGCTACCAGGTCTGTTGAGG + Intronic
926791271 2:16574508-16574530 CTAGGCTTCCAGGCCTGTAATGG - Intronic
927804672 2:26136221-26136243 CTAGGCTACCAAGCTGCTAGAGG - Exonic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
933190364 2:79327609-79327631 CAAGGCTACCAGGTCTCAACAGG + Intronic
933400884 2:81795370-81795392 CTAGGCTTCCAGGCCTCTTATGG - Intergenic
935698544 2:105790531-105790553 CTAGGAAACCAGGGCTCCAGAGG - Intronic
936431730 2:112470678-112470700 TTAGGCTTCCAGGTTTCAAGGGG - Intergenic
939997926 2:148937534-148937556 CTAGGCTAACAGGTGTCTGGAGG + Intronic
941335723 2:164241050-164241072 CTAGGCTTCCAGGTCTGTGATGG + Intergenic
942908022 2:181206770-181206792 CTAGGCCTCCAGGTCTGTAATGG + Intergenic
942950039 2:181712037-181712059 CTAGGCTTCCAGGTCTGTGATGG - Intergenic
1170415580 20:16135532-16135554 CAAGGCTACCATGGATCTAGGGG - Intergenic
1170643918 20:18179626-18179648 CTAGGCTTCCAGGTCTGTGATGG + Intronic
1179100669 21:38353154-38353176 CTAGGCTACCCGGCCTCTGCTGG - Intergenic
1184028632 22:41877502-41877524 CTTGGCTACCAGGTCCCAAAGGG + Intronic
1184730446 22:46368575-46368597 CTCAGCTACCAGGTCACCAGGGG + Intronic
951058272 3:18173272-18173294 CTAGGCTTCCAGGTCTGTGATGG + Intronic
952357868 3:32601346-32601368 CCAGGTTCCCAGGTCTCCAGAGG - Intergenic
953362663 3:42312076-42312098 CTAGGCGATCAGATCTCTTGAGG + Intergenic
956363168 3:68470929-68470951 CTAGGCTTCCAGGTCTGTGGTGG - Intronic
959561091 3:107782349-107782371 CTAGGCTACCATTTCTGTATTGG - Intronic
960908742 3:122627407-122627429 CCAGGCTAACATGTCTATAGGGG - Intronic
961628697 3:128281044-128281066 CTAGGCAAACAGGTCTCTGCAGG + Intronic
963339815 3:144020381-144020403 CTAGGCTTCCAGGTCTGTGATGG + Intronic
964701635 3:159574401-159574423 CTAGGCAAACAGGTCTGGAGTGG - Intronic
976790333 4:88870994-88871016 CTAGGCAAACAGGTCTGGAGTGG + Intronic
979933014 4:126655868-126655890 CTAGGCTGCCAGATCACTTGAGG - Intergenic
986507831 5:8470960-8470982 CTAGGCTACCAGGCCTGTGATGG + Intergenic
987862002 5:23500684-23500706 CTAGGCCTCCAGGCCTCTAATGG + Intergenic
988521195 5:31947040-31947062 CTGGGATACCAGGTCTACAGTGG - Intronic
995352886 5:111202067-111202089 CTTGGCTGACAGGTTTCTAGGGG - Intergenic
997964846 5:138348726-138348748 CTAGGCTACCAGGTCTCTAGGGG + Exonic
1001323005 5:170698286-170698308 CAAGGCCACCAGGTATCAAGTGG + Intronic
1005193819 6:23259544-23259566 CTAGGCAAACAGGTCTGGAGTGG - Intergenic
1006900436 6:37497044-37497066 CTAGAGTACCAGGTCTATGGTGG - Intronic
1007367990 6:41408003-41408025 CTAGTCTACCAGCTCCCCAGGGG + Intergenic
1008663853 6:53696873-53696895 CTAGGCTAGCAGGTCCATGGGGG + Intergenic
1009686468 6:66964012-66964034 CTAGGCTAGCACCTCTGTAGAGG - Intergenic
1015677138 6:135762589-135762611 CTAGGCTTCCAGGTCTGTGATGG + Intergenic
1016143693 6:140644134-140644156 CTAGGCTTCCAGGTCTGTGATGG + Intergenic
1019780715 7:2938249-2938271 CTATGTTACCTGGTCTGTAGTGG - Intronic
1021977196 7:26022024-26022046 CAAGGCTTCCATATCTCTAGAGG + Intergenic
1028784194 7:94773696-94773718 CTAGTCTTCCAGGTCTGTAATGG - Intergenic
1030495213 7:110290157-110290179 CTAGGCTACTTGGTAACTAGAGG + Intergenic
1034750090 7:153560269-153560291 CTAGGCTTCCAAGTCTGTGGTGG + Intergenic
1034999994 7:155604733-155604755 CGAGGCTCCCAGGTCTCCAGAGG - Intergenic
1037263656 8:17035932-17035954 CTAGGCTTCCAGGTCTGTGGTGG - Intronic
1038721932 8:30045021-30045043 CAAGGCGAGCAGGTCTCTTGAGG + Intergenic
1041425810 8:57719084-57719106 CTAGGTTACCAGTTTTCTAAGGG - Intergenic
1043561607 8:81500086-81500108 CTAGGCCTCCAGATCTCTAAAGG - Intergenic
1046368616 8:113271333-113271355 CTAGGCTTCCAGGTCTGTAATGG - Intronic
1048039052 8:130707215-130707237 CTAGGCCTCCAGGTCTTTAATGG + Intergenic
1052930165 9:34049378-34049400 CTCGGCTCTAAGGTCTCTAGGGG - Intergenic
1057359213 9:94357950-94357972 CAAGGCAACCAGGCCTTTAGTGG + Intergenic
1057648548 9:96899640-96899662 CAAGGCAACCAGGCCTTTAGTGG - Intronic
1059569152 9:115415709-115415731 CTAGGCTAACAAGGCCCTAGGGG - Intergenic
1187727106 X:22214666-22214688 CTAGGCCAAGAGGGCTCTAGTGG + Intronic
1190632357 X:52400290-52400312 CTAGGCTCCCAGGTCTTTCCTGG + Intergenic
1190974496 X:55386418-55386440 CTAGGCTTCCAGGTCTCTGATGG - Intergenic
1193695891 X:84707439-84707461 CAAGTCTACCAGCCCTCTAGAGG - Intergenic
1196796113 X:119503202-119503224 CTAGGCTGGCAGCTCTCCAGGGG - Intergenic
1198956215 X:142134699-142134721 CTAGGCCTCCAGGTCTGTAATGG - Intergenic
1199178493 X:144822508-144822530 GTAGTCTACCAGGTCTATATAGG + Intergenic
1199370448 X:147042108-147042130 CTAGGCTTCCAGGTCTGTGATGG - Intergenic
1199560708 X:149159726-149159748 CTAGGCTTCCAGGTCTGTGATGG + Intergenic