ID: 997965478

View in Genome Browser
Species Human (GRCh38)
Location 5:138352872-138352894
Sequence CGCTGCCGCCGCGGGAGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 426}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997965478_997965491 27 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965491 5:138352922-138352944 CGCACTCGAGCCTGGCGGGCCGG 0: 1
1: 0
2: 0
3: 20
4: 598
997965478_997965488 19 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965488 5:138352914-138352936 CTGCGCTGCGCACTCGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 288
997965478_997965485 -5 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965485 5:138352890-138352912 CAGCGGCGAGCGGAGATCCGGGG 0: 1
1: 0
2: 1
3: 3
4: 56
997965478_997965489 22 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965489 5:138352917-138352939 CGCTGCGCACTCGAGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 100
997965478_997965484 -6 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965484 5:138352889-138352911 GCAGCGGCGAGCGGAGATCCGGG 0: 1
1: 0
2: 2
3: 11
4: 161
997965478_997965490 23 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965490 5:138352918-138352940 GCTGCGCACTCGAGCCTGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 116
997965478_997965483 -7 Left 997965478 5:138352872-138352894 CCTCGGCTCCCGCGGCGGCAGCG 0: 1
1: 0
2: 6
3: 45
4: 426
Right 997965483 5:138352888-138352910 GGCAGCGGCGAGCGGAGATCCGG 0: 1
1: 0
2: 2
3: 22
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997965478 Original CRISPR CGCTGCCGCCGCGGGAGCCG AGG (reversed) Exonic
900095698 1:939281-939303 TGCTGCTGCCGCGGGAGCTGGGG + Exonic
900138935 1:1130990-1131012 CACAGCAGCCTCGGGAGCCGGGG - Intergenic
900618470 1:3576219-3576241 CGCAGAAGCAGCGGGAGCCGTGG - Intronic
900787107 1:4655826-4655848 CGCGGCGGGCGCGGGGGCCGGGG + Intronic
901002281 1:6154769-6154791 CGCCGCCGCCGCTGCTGCCGCGG + Exonic
901433937 1:9234864-9234886 TGCGGCCGCCGCGGGCTCCGCGG + Exonic
901629009 1:10639208-10639230 CGCCGCCGCCGCCGCAGCTGGGG - Exonic
901643413 1:10704517-10704539 GGATGCCGCGGTGGGAGCCGGGG + Intronic
902067468 1:13700214-13700236 CGGCGCGGCCGCGGGCGCCGGGG + Intronic
903072198 1:20732045-20732067 GGCTGCGGCGGCGGGAGACGCGG - Intronic
903398296 1:23019622-23019644 CGCTGCAGCCGCCGCCGCCGCGG - Exonic
903813172 1:26046050-26046072 TGCAGCCGCAGCGGGAGCCGGGG - Exonic
903897766 1:26620351-26620373 CGCAGCTGCCGCCGGGGCCGTGG - Intergenic
904005441 1:27360945-27360967 CGCCTCCTCCGCGGGCGCCGTGG + Exonic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904517227 1:31065759-31065781 CGCTGCCACCGCCGGGGCCGGGG - Intronic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904940768 1:34164070-34164092 CGCTGCCGCTGCCGCAGCCGAGG + Intronic
905422629 1:37859138-37859160 CGTTGCCGCCGAGGGTGCCGGGG - Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906480949 1:46198469-46198491 CGCCGCCGCCGCCGCTGCCGCGG + Intronic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907501953 1:54887376-54887398 CCCCGCCGCCGCGCGAGGCGGGG + Intergenic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
910759003 1:90717598-90717620 CGCCGCCGCCGCCGCTGCCGGGG + Intergenic
910759040 1:90717721-90717743 GGCTGCCACCTCGGGAGCCGCGG - Intergenic
911203798 1:95072856-95072878 AGCTGCGGCCGCAGGAGCTGTGG - Exonic
912345883 1:108963160-108963182 AGCCGCCGGCGCGGGAGCTGAGG + Intronic
912416226 1:109509742-109509764 CGTCGCCGCCGCCGGAGCCTCGG + Intergenic
913186529 1:116374052-116374074 GGCTGCCCCCGCCGGAACCGGGG - Exonic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
914803113 1:150974608-150974630 CGCTGCCGCCGGGTGAGTCGGGG - Exonic
914919545 1:151838226-151838248 CGGTCCCGCCCCGGGAGCGGCGG - Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915953496 1:160205426-160205448 GGCGGCGGCGGCGGGAGCCGAGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
919748619 1:201023452-201023474 GGCTGCGGCTGCGGGAGGCGGGG + Exonic
919988937 1:202695463-202695485 TGCTGACACTGCGGGAGCCGGGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922496447 1:226062067-226062089 CGCTGCGGCAGCGGGAGGGGCGG - Intronic
923506205 1:234608849-234608871 CGCTGCCGCCTCCTTAGCCGCGG - Exonic
924527427 1:244864392-244864414 CGCAGCCGCCGCCCGGGCCGAGG - Exonic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1063201105 10:3785727-3785749 CCCTGTCGCCGCGCGAGCCCCGG + Intergenic
1063664094 10:8051499-8051521 CGCCGCCGCCGCAGGGCCCGGGG - Intergenic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064384659 10:14879200-14879222 CGAGGCCGCCACGGGAGACGCGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1067481122 10:46598189-46598211 CCCTGCCGCGAGGGGAGCCGCGG + Intergenic
1067613630 10:47743633-47743655 CCCTGCCGCGAGGGGAGCCGCGG - Intergenic
1068767348 10:60778535-60778557 AGCTGCCGCTGCGGCCGCCGCGG + Exonic
1070809858 10:79292235-79292257 CGCTGCTGCAGCGGCTGCCGCGG - Exonic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1071997702 10:91163400-91163422 CGGCCCCGCCGCGGGAGCAGCGG + Intronic
1071997803 10:91163813-91163835 CGCTGCCCGCGCGCGTGCCGGGG + Intronic
1072465176 10:95656466-95656488 CGCTGCCGGAGCAGGTGCCGGGG - Intronic
1072637338 10:97186342-97186364 AGCTGGGGCCGCGGGTGCCGGGG - Intronic
1072915525 10:99535457-99535479 CGCCGCCGCCGCCGCAGCAGCGG + Exonic
1072915527 10:99535460-99535482 CGCCGCCGCCGCAGCAGCGGCGG + Exonic
1075054583 10:119207808-119207830 CGCCGCTGCTGCCGGAGCCGGGG - Exonic
1075129495 10:119726069-119726091 CGCTGCCGCCGCCGCTGCCGGGG + Intergenic
1075520024 10:123137617-123137639 GGCTGCAGCCGCGGGGGCCCCGG + Exonic
1076192537 10:128492768-128492790 TGCTGCCTCCGCGGGAGCCCTGG + Intergenic
1076358201 10:129867992-129868014 CGCGGCCACCGCGGGAGGAGAGG + Intronic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076848536 10:133081852-133081874 CGGTGCTGCCGAGGGAGCCCTGG - Intronic
1077074666 11:694939-694961 CGCGGCCGCGGCAGGAGGCGAGG - Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077367327 11:2166451-2166473 CGCGGCCTCGGAGGGAGCCGGGG - Intronic
1078150862 11:8758739-8758761 CGCTGCGGTGGAGGGAGCCGCGG - Intronic
1079361951 11:19777112-19777134 CGCTGGGGCCGCGGCGGCCGAGG - Intronic
1079459769 11:20669503-20669525 CGCCGCCGCCGCGCCAGCGGTGG + Intergenic
1080606640 11:33869634-33869656 CGCGGCCGAGGCGGGGGCCGGGG + Intronic
1080628608 11:34052498-34052520 TGAGGCGGCCGCGGGAGCCGGGG + Exonic
1081700080 11:45147107-45147129 TGCCGCCGCCGCGGGAGCCGGGG + Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1084129034 11:67119339-67119361 CGCCGCCGCCGCCGCTGCCGGGG - Intronic
1084151367 11:67289344-67289366 CGCTACTGCTGCGGGGGCCGCGG + Exonic
1085624856 11:78064099-78064121 GGCTGCTGCCGCGGGAGGAGTGG + Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1086887855 11:92225057-92225079 CGCTGCGGCGGCAGCAGCCGGGG + Intergenic
1087456846 11:98397132-98397154 CGCTGCCCCCTCCAGAGCCGTGG - Intergenic
1088256498 11:107908395-107908417 CGCCGCCGCCGCAGACGCCGCGG + Intronic
1088462041 11:110092839-110092861 CGTCGCCGCCTCTGGAGCCGAGG - Intergenic
1089493697 11:118898388-118898410 CGCTGCCAGGGCTGGAGCCGGGG - Exonic
1089496519 11:118910943-118910965 CGCCGCCGGAGCGGGAGGCGCGG + Intronic
1089564634 11:119364225-119364247 CGCTGACGTCGCGGGGCCCGAGG - Intronic
1090636809 11:128694640-128694662 CGCTGGGGCCACGGGAGCCCCGG - Intronic
1090860533 11:130648679-130648701 CACTGCTGCCGCCGGAGCCAGGG + Intergenic
1090959440 11:131543040-131543062 CGCTGCCTCCCAGGGAGCTGAGG + Intronic
1091718386 12:2795478-2795500 CGCTGCCGGCTGGGGAGCCTGGG - Intronic
1092727680 12:11500714-11500736 CGCTGCCGCCGCCACCGCCGGGG + Intronic
1092810394 12:12266928-12266950 CGCTGGCGTCGCGCGAGCCCGGG - Intronic
1093435341 12:19129744-19129766 TGCTGCCGCCGCGGCTGCCGAGG - Intronic
1093547787 12:20368859-20368881 CGCTGACGCTGGAGGAGCCGGGG - Intergenic
1096157048 12:49346628-49346650 CGCTGCGGCCCCGGGTGCCCCGG + Intergenic
1096627382 12:52903977-52903999 CGCTGCCGGCGCAGGGGCCGGGG + Intronic
1096983594 12:55743065-55743087 CGCTGACGACACGGGGGCCGGGG + Intergenic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097057391 12:56258176-56258198 CGCTGCCGTCACGCGAGCCCGGG - Intronic
1097929626 12:65169829-65169851 CGCCGCCGCCGCTGGTCCCGCGG - Exonic
1098161031 12:67648632-67648654 GGCCGCGGCCGGGGGAGCCGGGG + Intronic
1098426061 12:70366537-70366559 CGCTGCCGCCGCCGCCGCCGGGG + Exonic
1099437273 12:82659538-82659560 CGCTGCGGCAGCGGGTTCCGGGG - Intergenic
1101253832 12:102958363-102958385 CGCTGCCGCTGCGGCGGCTGCGG - Exonic
1101466926 12:104958370-104958392 CGCCGCCGCCGGGGAAGCCCGGG + Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102588634 12:113940862-113940884 TGCTGTCGCTGCGGGAGCTGAGG - Intronic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103509862 12:121467014-121467036 CGCTGCCGGCGGGGCGGCCGGGG - Intronic
1103527799 12:121579366-121579388 CTCTGCCGCCGCGGCCGCTGGGG - Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1104448817 12:128853491-128853513 CGCGGACGGCGGGGGAGCCGGGG - Intronic
1104624320 12:130339098-130339120 CGCTGCGCCCCCGGGAGCCTTGG + Intronic
1105240916 13:18609305-18609327 CGCTGCGGCCGGAGGAGCTGGGG + Intergenic
1105454225 13:20525713-20525735 CGCTGCTGCCCCTGGAGCCCGGG - Intronic
1106087649 13:26557790-26557812 CGGTCCCGCCGCCGGCGCCGGGG - Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1110630062 13:77697733-77697755 GGCTGCCGCGGCCGGAGGCGAGG + Intergenic
1112012090 13:95301191-95301213 CCCTGCAGCCGCTGGCGCCGCGG - Intronic
1112091684 13:96090431-96090453 AGCTGCGGCCGCGAGCGCCGGGG - Intergenic
1112216278 13:97434178-97434200 CGCTGGTGCCGCCCGAGCCGCGG - Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112505215 13:99971040-99971062 CATGGCCGCCGCGGGGGCCGTGG + Exonic
1115320819 14:32077370-32077392 CGCTGCCGCCGCCACCGCCGGGG + Exonic
1116657969 14:47674982-47675004 CGCCGCCGCCGCCGCAGCTGCGG - Intergenic
1116887040 14:50231643-50231665 CGCGGCCGTAGCGGGAGTCGGGG - Intergenic
1116945397 14:50831028-50831050 CGGCGCCGCCGCGGGAACCATGG + Exonic
1117119626 14:52553246-52553268 CGCTGCAGCCTCAGGCGCCGCGG + Exonic
1117131952 14:52695673-52695695 GGCTGCCGGCGCGGGCGCCGCGG - Exonic
1118186539 14:63543127-63543149 CGCCGCCGCCGCCGGGTCCGGGG - Exonic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118776977 14:68979317-68979339 CACTAGCGCTGCGGGAGCCGAGG + Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1122130812 14:99603927-99603949 CGCCGCCGCCGCCGTCGCCGCGG + Exonic
1122137859 14:99645134-99645156 CCCTGCCGCCGCGAGCGCCCCGG + Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1123024883 14:105419872-105419894 CGCCGCCGCCGAGGCCGCCGAGG - Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1124527582 15:30471288-30471310 CGGTGGCGCCGCCGCAGCCGTGG - Intergenic
1124771077 15:32536414-32536436 CGGTGGCGCCGCCGCAGCCGTGG + Intergenic
1124848083 15:33311027-33311049 CGCCGACGCCTCGGGAGCCATGG + Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125664185 15:41417206-41417228 GGCGGCCGGCGTGGGAGCCGGGG + Exonic
1126944888 15:53808686-53808708 CGTTGCCGCCTCAGGAGCCAAGG - Intergenic
1127982702 15:64046327-64046349 CGCTCCCGCCGCGCCTGCCGCGG - Intronic
1128766580 15:70254802-70254824 GGCTGCGGCCGGGGGAGGCGGGG - Intergenic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129893794 15:79089539-79089561 CGCTGCCTCCGCAGCAGCCCTGG + Intronic
1130115596 15:81002089-81002111 GGCTGCGGCGGCGGGAGCCCGGG - Exonic
1131977476 15:97960882-97960904 CGCGGCGGCCGTGGGTGCCGAGG + Exonic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1133188393 16:4116164-4116186 TGCGGCCGCGGCGGGAGCGGCGG - Exonic
1134172105 16:11976852-11976874 AGCTGGAGCGGCGGGAGCCGGGG - Intronic
1134419319 16:14071326-14071348 CGCGGCGGCGGCGGGAGCGGCGG + Intronic
1136428285 16:30183504-30183526 GGCGGCCGCAGCGGGAGCCCGGG + Exonic
1136551748 16:30985741-30985763 TGCTGCTGCAGCGGGAGCCCCGG + Exonic
1138023107 16:53502752-53502774 CGATGCTGGCCCGGGAGCCGCGG + Intronic
1138590432 16:57996549-57996571 TGCCGCCGCCGCGGCAGCGGAGG - Exonic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1141177516 16:81730605-81730627 CGTTGCAGCTGCGGGAGCCCGGG + Intergenic
1141770962 16:86089434-86089456 CGCTGCAGCCGAGGGATCCCAGG + Intergenic
1142605486 17:1078865-1078887 CGCTCCCGCCGCGGGGACAGAGG - Intronic
1143026529 17:3944798-3944820 CCCTGCCGCCTGCGGAGCCGGGG + Exonic
1143478895 17:7217577-7217599 GGCAGCGGCCGAGGGAGCCGTGG + Intronic
1144565112 17:16353353-16353375 CGCGGAGGCCGCGGGGGCCGCGG + Exonic
1144781943 17:17812809-17812831 TGCTCCCGCCGCGTGGGCCGCGG + Exonic
1144909911 17:18672510-18672532 CGCTGCCACCGCCGCAGCCGGGG - Intronic
1145380440 17:22383961-22383983 CGCGGCTGCCGCTGGATCCGGGG - Intergenic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146956054 17:36936898-36936920 CGCTGTCGCCGCCCGGGCCGCGG - Intronic
1147123706 17:38351950-38351972 CGCTGTCGCTCCGGGGGCCGCGG + Intergenic
1147285740 17:39401576-39401598 CGTTGCGGCCGCCGGCGCCGCGG - Exonic
1149994707 17:61400361-61400383 TGCTGCCGCCGCCGCCGCCGCGG - Exonic
1150060677 17:62065686-62065708 CGCTGCCGCGCCGGGGGCCTGGG - Intergenic
1150212072 17:63446860-63446882 CGCCGCCGCTCCGGGAGCCCTGG + Intergenic
1151678098 17:75610230-75610252 CTCTGCCGCCTCTGGAGCAGGGG - Intergenic
1152677260 17:81648067-81648089 CGCAGCCACCGCCGGAGCGGCGG - Exonic
1152798786 17:82321665-82321687 CGCGGCAGCCCCGGGGGCCGAGG - Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153900616 18:9614505-9614527 CGCGGCCGCCCGGGGAGCCGGGG + Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1154303864 18:13217393-13217415 CGCCGAGGCCGCGGGACCCGGGG - Intergenic
1154448054 18:14450603-14450625 CGCTGCGGCCGGAGGAGCTGGGG - Intergenic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1155392627 18:25351870-25351892 TGCTGCCGCCGCCGCTGCCGAGG - Intronic
1157545201 18:48541383-48541405 CGCCGCCGCTGCTGGAGCCAGGG + Intronic
1157662819 18:49460480-49460502 CGCTGTCGCCGCCGCAGCCCAGG + Exonic
1157867329 18:51197633-51197655 CGCCGCCGCCGCGCGCGCCGGGG - Intronic
1158976717 18:62716492-62716514 GGCTGGCGCCCCCGGAGCCGCGG + Exonic
1160499972 18:79396607-79396629 CGCTTCCTCGGCGGGACCCGCGG - Intronic
1160500781 18:79400357-79400379 CGGGGCCGGGGCGGGAGCCGGGG - Intronic
1160554089 18:79714924-79714946 GGCTGCCCCAGAGGGAGCCGGGG + Exonic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1161428376 19:4216894-4216916 AGCTGAGGCCACGGGAGCCGAGG + Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162751763 19:12833861-12833883 CGCCGCCGCCGCGGTCCCCGCGG + Intronic
1163138611 19:15331850-15331872 AGCGGCCGCCGCGGGGTCCGCGG - Intronic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163427093 19:17245741-17245763 AGCGGCAGCCGCGGGCGCCGGGG - Exonic
1163586951 19:18169347-18169369 GGCTGCGGCGGCGGGAGCCACGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1165443902 19:35846150-35846172 CGCGGCTGCCGCAGGAGTCGCGG - Exonic
1165447155 19:35862616-35862638 GGCTGGGGCCTCGGGAGCCGGGG - Intronic
1165745805 19:38229077-38229099 CCCTGCGGCCGCGAGGGCCGGGG + Intronic
1165879438 19:39032061-39032083 CGCTGCCGCCAAGTGTGCCGGGG - Exonic
1165938314 19:39402933-39402955 CCCGGCCGCCGCTGGGGCCGCGG + Intergenic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166679537 19:44758402-44758424 CGCAGCCGCAGGGTGAGCCGGGG + Exonic
1166852837 19:45768658-45768680 CGCAGCGGCTGCGGGAGCTGAGG - Exonic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
926914409 2:17878699-17878721 CGCCGCCGCGGCGGCAGGCGCGG + Intronic
927156549 2:20224456-20224478 CCCGGCCGCCGCGGTGGCCGGGG + Intronic
927168768 2:20350947-20350969 CGCTGCCGCCGCGCGGGCCGGGG + Intronic
927181101 2:20447289-20447311 GGCTGCCGCGGCGGGGGCGGTGG - Exonic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927751382 2:25673467-25673489 CGCTGCCGCTGCCTCAGCCGAGG - Exonic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935237631 2:101151532-101151554 GGGAGGCGCCGCGGGAGCCGCGG - Intronic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592506 2:104855446-104855468 CGCCGCCGCAGCAGCAGCCGCGG - Intergenic
935592617 2:104855837-104855859 CGCTGCCGCCGCCGCCGCCGTGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935692615 2:105744881-105744903 CGCCGCCGCCGCCGCTGCCGCGG + Exonic
936104481 2:109613639-109613661 CCCGGCCGCCGCGGAAGCCGGGG + Intronic
940774909 2:157875795-157875817 CCCGGCCGCGGCGGGACCCGAGG - Intronic
940954480 2:159712640-159712662 CGGTGCCGGCTCAGGAGCCGGGG + Intronic
941666377 2:168247334-168247356 CGCTGCTGTCGCGGCCGCCGGGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942446199 2:176080431-176080453 CGCAGCCGCTGCGGCTGCCGCGG + Exonic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945431725 2:209772234-209772256 CGCTGCCGCCGCCGCCGCTGAGG + Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946191640 2:218010670-218010692 AGCAGCAGCCGCGGGAGCCGGGG + Intergenic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947523357 2:230864841-230864863 CGCAGGCGCGGCGGGCGCCGGGG + Intronic
947549793 2:231037909-231037931 CGCTGGCCGCCCGGGAGCCGCGG + Exonic
948207742 2:236171577-236171599 CGCTGCCGCCGCCAGAGTCGAGG + Intergenic
1170150267 20:13220988-13221010 CGCTGCCGCCGAGGGCGCCCCGG + Intergenic
1172039086 20:32031266-32031288 CGCTCCCGCCCCTGGAGCCCCGG - Exonic
1172100851 20:32483458-32483480 TGCTGCCGCCGCGGCTGCCCGGG + Exonic
1172429312 20:34876670-34876692 CGGAGCGGCAGCGGGAGCCGGGG + Exonic
1172702883 20:36863559-36863581 CGGAGCCGCAGCCGGAGCCGGGG - Exonic
1173548184 20:43914911-43914933 CGCGCCCACCGCGGGCGCCGAGG - Exonic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173681554 20:44885791-44885813 CGCTGCCGCCGCCTGAGTAGTGG + Exonic
1173790385 20:45824266-45824288 CGCTGGGGGCCCGGGAGCCGAGG - Intronic
1175847236 20:62065366-62065388 CGCCGCCGCCGCCGTCGCCGCGG - Exonic
1175890393 20:62313418-62313440 CGATGCAGCCCCGGTAGCCGGGG + Exonic
1176042369 20:63072325-63072347 CGCTGCTGCCCCCGGACCCGCGG - Intergenic
1176376912 21:6091408-6091430 CGGTGGCGCGGCGGGAGGCGTGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1178487363 21:33027549-33027571 TGCTGCCGCCGCTGCAGCCGCGG + Exonic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1179453430 21:41480985-41481007 TGCTGCCACCTCCGGAGCCGTGG - Intronic
1179626834 21:42653745-42653767 GCCAGCCGCCGCGGGAGGCGGGG - Exonic
1179746563 21:43446836-43446858 CGGTGGCGCGGCGGGAGGCGTGG - Intergenic
1180108440 21:45634884-45634906 GGCTGCTGCTGTGGGAGCCGTGG + Intergenic
1180649956 22:17369505-17369527 GGCGGCCGCCGCCGCAGCCGCGG + Exonic
1180891407 22:19291655-19291677 CGCTGCCGCCGCCGCCGCCGAGG - Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181312527 22:21952876-21952898 CCTGGCCGCCGCGGGCGCCGCGG + Intergenic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182771859 22:32801976-32801998 CGCTGCTGCCGCCGCTGCCGGGG - Exonic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184663711 22:45976941-45976963 CGCCACCGCCGCGTGAGCCCGGG + Exonic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185418059 22:50720752-50720774 AGCTGCCGCCGCCGGGACCGGGG - Intergenic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
949414382 3:3799849-3799871 TGCTGCCGCCGCCGCCGCCGTGG + Exonic
949895893 3:8767461-8767483 CGCTGCAGCGGCGGCGGCCGAGG - Exonic
949970242 3:9397672-9397694 CGCCGCCGCCGCCGCTGCCGGGG + Intronic
950575765 3:13831251-13831273 CGCTGCCTCCGAGGTAGCTGCGG + Intronic
950745190 3:15082516-15082538 TGCTGCCTCGGCGGGAGCCATGG + Exonic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951613950 3:24521824-24521846 CGCCGCAGCCGCTGGAGCCTTGG + Intergenic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952908882 3:38165601-38165623 CGCTGCTGCTGCGGAGGCCGAGG + Exonic
953099323 3:39809694-39809716 CGCAGCCGCAGCGGGAACCCGGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954004186 3:47578741-47578763 CGCGGCGGCCGGGCGAGCCGAGG - Exonic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
959849713 3:111071959-111071981 CGCCGGGGCCGGGGGAGCCGGGG + Exonic
960096752 3:113696666-113696688 AGCTGCGGCCGCGGGAGGGGCGG - Intergenic
961487617 3:127227692-127227714 CGCTCCCTCCTCGGGAGCCTTGG - Intergenic
961674274 3:128555390-128555412 CGCGGCGGCCGCGGGCGCTGCGG + Intergenic
963904469 3:150762691-150762713 CGCCGCCGCGGCGGGCACCGCGG + Exonic
965881655 3:173395654-173395676 TCCTGCCGCCGCGGGCGCTGCGG + Intergenic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968178202 3:196569071-196569093 CTCTGGGGCCGCGGGGGCCGGGG + Exonic
968405495 4:336745-336767 CGCTGCAGCCGCTGGAGCCGGGG - Intergenic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968815070 4:2817900-2817922 CACGGCCGGCGCGGGAGCCTCGG - Intronic
969138606 4:5050806-5050828 GGCTCCCGCCGCAGGAGCCCAGG + Intergenic
969912857 4:10461323-10461345 CTCGGCCGCCGCGGCTGCCGCGG + Intergenic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
972585357 4:40432707-40432729 TGCTGCTGCCGCCGCAGCCGCGG - Exonic
975986254 4:80203226-80203248 CGCTGCAGCCGCGGCTGCGGCGG + Exonic
975986256 4:80203234-80203256 CGCGGCCGCCGCCGCAGCCGCGG - Exonic
977574009 4:98658416-98658438 CGCCGAGGCCGCCGGAGCCGGGG + Exonic
979685316 4:123505639-123505661 CGCTGCCGCCGCCGCCGCCGAGG + Intergenic
981782206 4:148442729-148442751 CGCAGCCGCGGCGGGAGCTTGGG + Intronic
984947268 4:184979614-184979636 CGCTGCAGCCACGCCAGCCGGGG - Intergenic
984952611 4:185018472-185018494 CGCAGCGGCCGCGGGCACCGGGG - Intergenic
986152596 5:5140677-5140699 CGCTGCCGCTGCGGGTCCCATGG - Exonic
986748173 5:10761662-10761684 CGCTGCCGCGGCAGGGGCTGAGG - Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
986859022 5:11904512-11904534 CGCGGCAGCAGCGGCAGCCGCGG + Intergenic
989591958 5:43120901-43120923 AGCTGCCGCTGCCGGGGCCGCGG + Intronic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991736789 5:69635498-69635520 TGCTGCAGCTGCAGGAGCCGAGG - Intergenic
991813114 5:70490327-70490349 TGCTGCAGCTGCAGGAGCCGAGG - Intergenic
991816245 5:70511608-70511630 TGCTGCAGCTGCAGGAGCCGAGG - Intergenic
994043466 5:95284146-95284168 CGCGGCGGCCTCGGGAGCAGCGG - Exonic
994072615 5:95619938-95619960 CGCTACCCTCGCGGAAGCCGCGG - Intergenic
995106243 5:108381030-108381052 CGCTGCGGCGGCGGGGGCTGCGG - Exonic
995735534 5:115296489-115296511 TGCGGCCACCGCGGTAGCCGGGG - Exonic
996862476 5:128082975-128082997 CGCAGCCGCTTCCGGAGCCGCGG - Intergenic
996862814 5:128084232-128084254 CGCCGCCGCCGCCGCAGCAGCGG - Exonic
997302084 5:132813639-132813661 CGCCGCCGCTGCGGCTGCCGGGG + Exonic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
997975411 5:138439070-138439092 AGCAGCCGCCGCGGGGGCAGCGG - Exonic
998265474 5:140664807-140664829 CGCTTCCGCCTCGGGGGGCGGGG - Exonic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
999188432 5:149730149-149730171 CGCGGCGCCCGCGGGAGCCGGGG - Intergenic
1000319080 5:160119359-160119381 CGCTGCCGCCTCTGCAGCCACGG + Exonic
1000463525 5:161548837-161548859 CGCAGCCGCCGCGGGCTCCTCGG - Intronic
1002424504 5:179167286-179167308 CGCTGCTGCCGCGAGAACAGCGG + Intronic
1002424527 5:179167352-179167374 CGCTGGGGCCCCGGGAGCCCGGG - Intronic
1002927001 6:1610526-1610548 CGCGGCGGCCGCGGCGGCCGGGG + Exonic
1003390328 6:5707895-5707917 GGGTGCCGCCGTGGGAGCCCGGG + Intronic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1005838247 6:29723787-29723809 GGATGGAGCCGCGGGAGCCGTGG + Exonic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1006502151 6:34465952-34465974 TGCTGCCTCCCCGGCAGCCGCGG + Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1011470333 6:87701844-87701866 CGCTGCCGCCGCTGCCTCCGCGG + Exonic
1013273403 6:108561603-108561625 CGCTGCCACCGCCGCAGCCGGGG + Exonic
1014569985 6:122996668-122996690 CGCCGCCGCTGCTGAAGCCGCGG + Exonic
1015148925 6:130018507-130018529 CGCCGCCGCCGCCGCTGCCGGGG - Exonic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1016658087 6:146543784-146543806 CGCGGCCGCCGGGGGCGCGGCGG + Exonic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1018400377 6:163414786-163414808 CGCCGCCGCCGCCTGTGCCGCGG - Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1019111964 6:169724081-169724103 CCCTGCCGCCGCGCGCCCCGCGG + Intronic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020016892 7:4836438-4836460 CGCTGCCGCCCAGGGCCCCGAGG - Exonic
1020131680 7:5562470-5562492 CGCAGCCTCAGCGGGAGCAGGGG + Intronic
1020281657 7:6653168-6653190 GGCGGCCGCCGCGGGGCCCGAGG + Exonic
1021451304 7:20785544-20785566 CGCGGCCGCCGCAGCCGCCGAGG + Exonic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1022106221 7:27199711-27199733 GGCTGCCGCCGCTGCTGCCGCGG - Exonic
1022106253 7:27199829-27199851 CGCGGCCGCCGCCGCAGCCGCGG + Exonic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615707 7:63114421-63114443 CGCTGCCGCGGCGGCGGCGGCGG + Intergenic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1025709250 7:63891887-63891909 TGCTGCCGACCAGGGAGCCGTGG - Intergenic
1025729988 7:64100444-64100466 CGCGGCCGCTGCGGGAGCTGCGG + Intronic
1029204829 7:98863347-98863369 CCCTGCCACCACGGGAGCGGTGG - Exonic
1029437804 7:100572688-100572710 CGCTGCCCCCGGGGCAGCAGAGG + Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1031043449 7:116862571-116862593 CGCTGCCGCCGCCGCCGCCGCGG + Exonic
1032068796 7:128791508-128791530 CGGAGCCGGCGCGGGAGCCGCGG + Intronic
1033186570 7:139231834-139231856 AGCAGCCGCCGCGGCCGCCGAGG + Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034414717 7:150958392-150958414 CGCGGGCGCCCCGGGGGCCGTGG - Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034522628 7:151632327-151632349 CGCCGCCGCCGCAGGTGGCGCGG + Intronic
1035169498 7:157009829-157009851 CGCAGCCGCCGCCGCCGCCGCGG + Exonic
1035726765 8:1829561-1829583 AGCTGCCTCCACGGAAGCCGCGG + Intronic
1038319477 8:26514096-26514118 CGCTGTAGCCGCGGGGGGCGTGG + Intergenic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041201639 8:55455245-55455267 CGCAGCCGCTGCGGCCGCCGCGG - Intronic
1041271538 8:56113840-56113862 CGCGGCAGCCGCGGGGCCCGAGG + Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1042040035 8:64580732-64580754 CGCTGCCGCCGCCGCCGCCTCGG - Exonic
1042137399 8:65645120-65645142 GGCGGCCGGCGCGGGAACCGGGG - Intronic
1042532869 8:69833008-69833030 CGCCGCCGCCGCTGGGCCCGCGG + Exonic
1042837754 8:73093070-73093092 CGCAGGCGCCGCCGGAGCCCTGG - Exonic
1045111118 8:98940317-98940339 CTCCGCCGCTGCGGCAGCCGAGG + Intronic
1045509964 8:102806551-102806573 CGCGGCCTCCGGGGGAGGCGGGG - Intergenic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045738019 8:105318860-105318882 GGCGGCGGCGGCGGGAGCCGAGG + Exonic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049405923 8:142451841-142451863 CGTTGCCTCCTCGGCAGCCGGGG - Intronic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049688915 8:143950293-143950315 CGCTGCCGACGGAGGAGCAGCGG - Exonic
1049758155 8:144320001-144320023 CCCTGCGGCCGGGGGAGGCGGGG - Intronic
1049996801 9:1042605-1042627 CGCGGAGGCCGCGGAAGCCGGGG + Intergenic
1050091003 9:2016456-2016478 TGCTTGCGCCGCGGGAGCTGCGG + Intronic
1051287374 9:15510722-15510744 CGCGGCCCGCCCGGGAGCCGAGG - Intronic
1053240057 9:36487776-36487798 CCCTCCCGCCCCCGGAGCCGCGG - Intergenic
1053306208 9:36986344-36986366 CGCGGCCGCGGCGGGGCCCGGGG - Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1054798636 9:69325418-69325440 CGCGGCCGCAGCGGGGGCAGCGG - Intronic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514210 9:77020335-77020357 GGCGGCGGCCGCGGCAGCCGCGG + Exonic
1055514229 9:77020412-77020434 CGCGGCCGCGGCGGCAGCGGCGG - Exonic
1055936833 9:81611792-81611814 CGCAGCCGCCGCGGCCGCCGTGG - Exonic
1056154062 9:83817577-83817599 TGCGGCCGCCCGGGGAGCCGCGG - Exonic
1056356436 9:85805516-85805538 TGCGGCCGCCTGGGGAGCCGCGG + Intergenic
1057208133 9:93185207-93185229 CGCTGCGGGCGCGGGGGCGGCGG - Exonic
1057488566 9:95505903-95505925 CGCGGCGGCCGCGGCCGCCGGGG + Intronic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489188 9:95508547-95508569 CGCTGCTGCCGCTGCGGCCGCGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057489295 9:95508949-95508971 AGCAGCCACCGCGGGAGCAGCGG - Intronic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1057869777 9:98708894-98708916 CGCTGCCGCCGCCGCCGCCGCGG - Exonic
1057869882 9:98709251-98709273 CGCTGGCGCTGCGGCGGCCGCGG + Intergenic
1057881562 9:98796396-98796418 CGCGGCGGCTGCTGGAGCCGGGG - Exonic
1058058497 9:100473051-100473073 AGCTGTCGGCGCGGGAGCTGGGG + Intronic
1060634561 9:125189734-125189756 CGCCGCCGCCGCTGTTGCCGCGG - Exonic
1061415526 9:130445086-130445108 CTCTGCCTCCGCGGGCCCCGGGG - Intronic
1061583940 9:131554664-131554686 CGCGGGCGGCGCGGGAGCTGCGG - Intergenic
1062537748 9:137028285-137028307 CGCTGTCGCCGCGGCCGCCGGGG - Intronic
1062542070 9:137045940-137045962 CGCAGCAGCCGCAGGTGCCGCGG + Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185643376 X:1600454-1600476 AGGTGTGGCCGCGGGAGCCGAGG + Intronic
1187547313 X:20266716-20266738 CGCCGCCGCCGCCGCTGCCGTGG - Exonic
1188005497 X:25013547-25013569 AGGGGCCGCCGCGGCAGCCGCGG - Exonic
1190542867 X:51496503-51496525 CGCTGCCGCTGCCGCCGCCGGGG + Exonic
1192234332 X:69286185-69286207 CGCTGCGGCCGGGTGAGCCAAGG - Intergenic
1192630867 X:72777118-72777140 AGCAGCCGCCGCAGCAGCCGCGG + Intronic
1192650842 X:72943683-72943705 AGCAGCCGCCGCAGCAGCCGCGG - Intronic
1193117146 X:77786151-77786173 TGCCACCGCCGCAGGAGCCGCGG + Exonic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196684022 X:118495702-118495724 AGCTGCCGCCGCCGACGCCGTGG + Intergenic
1198807222 X:140504326-140504348 GGCTGCGGCCGCGGCAGCGGCGG + Exonic
1200100730 X:153688233-153688255 AGCCGCCGCCGCCCGAGCCGCGG + Exonic
1200128691 X:153829998-153830020 CGCTTCCGTCCCGGGAGGCGCGG - Intronic
1200146344 X:153928188-153928210 CGCGGGCGCCGTGGGAGCCTGGG + Intronic