ID: 997973687

View in Genome Browser
Species Human (GRCh38)
Location 5:138425665-138425687
Sequence ATTATATTCTGGGGCATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997973679_997973687 1 Left 997973679 5:138425641-138425663 CCCAGCTCTGCCCTTGAATAATA 0: 1
1: 0
2: 0
3: 18
4: 223
Right 997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG 0: 1
1: 0
2: 1
3: 27
4: 146
997973682_997973687 -10 Left 997973682 5:138425652-138425674 CCTTGAATAATAAATTATATTCT 0: 1
1: 0
2: 5
3: 77
4: 691
Right 997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG 0: 1
1: 0
2: 1
3: 27
4: 146
997973680_997973687 0 Left 997973680 5:138425642-138425664 CCAGCTCTGCCCTTGAATAATAA 0: 1
1: 1
2: 0
3: 14
4: 153
Right 997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG 0: 1
1: 0
2: 1
3: 27
4: 146
997973681_997973687 -9 Left 997973681 5:138425651-138425673 CCCTTGAATAATAAATTATATTC 0: 1
1: 0
2: 1
3: 45
4: 608
Right 997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG 0: 1
1: 0
2: 1
3: 27
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997973687 Original CRISPR ATTATATTCTGGGGCATAAT GGG Intronic
900905914 1:5557485-5557507 ATTGGACTCTGTGGCATAATGGG + Intergenic
906610892 1:47201520-47201542 CTTATATTGTGGGGAATAAATGG - Intergenic
908552723 1:65225770-65225792 ATTATATATTGGGGCACATTTGG + Intronic
911758452 1:101588428-101588450 ATAATATGCTGGGGCAATATAGG - Intergenic
911771093 1:101743565-101743587 ATTATAGTGTGGGGTATAATGGG + Intergenic
911979430 1:104548135-104548157 TTTATATTCTGTGGTATAAATGG - Intergenic
912267213 1:108170584-108170606 ATAAAATTCTGGGGATTAATTGG - Intronic
912319264 1:108694974-108694996 TTTATATTCTGGGGAATAATTGG + Intronic
912758530 1:112345663-112345685 ATTTTATTCTGGGGCTAACTGGG + Intergenic
912934465 1:113990930-113990952 ACTGTAGTCTGGGGCAGAATAGG + Intergenic
913298004 1:117340532-117340554 ATTATTTTCTGAGGCATAAATGG - Intergenic
916036929 1:160930479-160930501 AATATGTTCTGGCACATAATAGG + Intergenic
921855598 1:219979655-219979677 ATCATTTTCAAGGGCATAATAGG - Intronic
923178910 1:231497088-231497110 ATTATATTCTGTGGTATGGTTGG + Intergenic
923632714 1:235663946-235663968 ATTGTATTCTGAAGCATAAGAGG + Intronic
923953194 1:238984318-238984340 AATATATTCTGGGCCATTTTTGG - Intergenic
1063583610 10:7331409-7331431 ATTAGATTCAAGAGCATAATTGG - Intronic
1064800804 10:19069184-19069206 ATAATAATCTGTGGCATAATGGG - Intronic
1069283478 10:66684362-66684384 AGTATATTATGGGGTAAAATGGG + Intronic
1071543087 10:86505858-86505880 AACAGTTTCTGGGGCATAATGGG + Intronic
1080223673 11:29935521-29935543 ATTATATCCTGGGAAATAATAGG - Intergenic
1080724144 11:34878339-34878361 TTTATGTTATGGGGCATAATTGG - Intronic
1084375148 11:68771874-68771896 AAGATTTTCTGAGGCATAATGGG + Intronic
1084546986 11:69819459-69819481 ATAATTTTCGGAGGCATAATTGG - Intergenic
1086822371 11:91449451-91449473 ATTATAATCAGTGGCACAATGGG - Intergenic
1086867282 11:91995428-91995450 ATTAGGTACTGGGGCACAATGGG - Intergenic
1088205011 11:107382571-107382593 ATTATGTTCTAGAACATAATAGG - Intronic
1093070262 12:14701058-14701080 ATTATTTTATGGGGCAGGATAGG + Intergenic
1095606298 12:44071710-44071732 ATGAAATTCTGGGGCATCTTAGG + Intronic
1096728519 12:53585706-53585728 ATCAGTGTCTGGGGCATAATTGG - Intronic
1099736964 12:86580410-86580432 ATTATAGTCTGGTTCATAGTAGG + Intronic
1101385674 12:104255306-104255328 AGAACATTCTGGGGCATAATAGG - Intronic
1101457045 12:104844655-104844677 ATTATATTTTGGTTAATAATAGG + Intronic
1104838141 12:131805457-131805479 GTTCTCTTCTGGGGCATATTTGG + Intergenic
1105269048 13:18853695-18853717 ATTAAATTCAGAGACATAATAGG - Intergenic
1107922261 13:45221333-45221355 CTTATATTCTGGAGCAAAAATGG - Intronic
1109431651 13:62244264-62244286 ATTAAACTCTGGGGACTAATGGG + Intergenic
1110908491 13:80923404-80923426 AATATATTCTGTGGCAGAAGTGG - Intergenic
1111196354 13:84878862-84878884 AGTGTATCCTGGGGCATAAGTGG + Intergenic
1111553973 13:89855233-89855255 ATTATATTCTTGAGGATAATTGG - Intergenic
1116525507 14:45899468-45899490 TGTATATTAAGGGGCATAATAGG - Intergenic
1116946068 14:50836421-50836443 ATCATATTTTGGGGTATATTGGG - Intergenic
1117826771 14:59712349-59712371 ATTATATTCTGAGATATTATGGG + Intronic
1117885241 14:60354511-60354533 AATATATTCTGTGGTATAATTGG - Intergenic
1118595716 14:67433980-67434002 ATTACATTCTGTGGCACAAAAGG - Intergenic
1118914376 14:70089791-70089813 ATTATCTTTTGGGGGAAAATTGG - Intronic
1202830253 14_GL000009v2_random:20283-20305 ATTAAATTCAGGGACATAATAGG + Intergenic
1124224169 15:27875812-27875834 CTCATATTCTAGCGCATAATTGG - Intronic
1124856694 15:33396188-33396210 ATACTATTCTGGGCCAGAATAGG - Intronic
1126009826 15:44292020-44292042 ATATTATTCTGTGCCATAATAGG - Intronic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1127064699 15:55224759-55224781 ATTTTATTCTGGGGTGTGATGGG - Intronic
1130181184 15:81630180-81630202 AATATATTCTGGGACAAGATGGG + Intergenic
1133685767 16:8164074-8164096 AATATATTATGGTGCAGAATAGG + Intergenic
1138236037 16:55383436-55383458 ATTATTTTCTGGGGACTAACTGG - Intergenic
1139452017 16:67035700-67035722 ATTAAGTTCTGAAGCATAATTGG - Intronic
1139807381 16:69579245-69579267 ATTATATTCTCTGGAATATTGGG + Intronic
1142677453 17:1522763-1522785 CTTATATTCTGGGGCAGGATGGG + Intronic
1150864543 17:68835911-68835933 ATTATTTTCTGGGGCTTTGTGGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153596849 18:6734763-6734785 ACCATATTCTGGGGGATACTAGG + Intronic
1154418980 18:14206294-14206316 ATTAAATTCAGAGACATAATAGG + Intergenic
1154965491 18:21351655-21351677 ATTACATTCTGGGGTATGATAGG + Intronic
1155449548 18:25949542-25949564 ATTATATTTTGGGGAAAAAAGGG - Intergenic
1156789117 18:40950530-40950552 ATTCTATTTAGGGACATAATAGG - Intergenic
1156906911 18:42363738-42363760 ATTACATTCCTGGGCAAAATTGG - Intergenic
1157792220 18:50542858-50542880 AGTATATTCTGAGGCCTCATGGG - Intergenic
1158168037 18:54564058-54564080 ATTATAATTTTGGGGATAATAGG - Intergenic
1160003665 18:75052262-75052284 ATTATACAATGGGGCATAATAGG - Intronic
1160262236 18:77305302-77305324 ATTATAATCTCAGGCATAAATGG - Intergenic
1167191599 19:47993843-47993865 ATTATATTCTACAACATAATGGG + Intergenic
1202642438 1_KI270706v1_random:107489-107511 ATTAAATTCAGGGACATAATAGG - Intergenic
928317466 2:30257248-30257270 AGAATATTCTGGGGCAACATAGG - Intronic
930729237 2:54711516-54711538 CTTATCTTCTGGAGCATATTTGG - Intergenic
930986533 2:57595147-57595169 ATTATATTCCAGGGTATAAAAGG - Intergenic
934498276 2:94830928-94830950 ATTAAATTGAGGGACATAATAGG - Intergenic
935845271 2:107159534-107159556 ATTAGATTCTGGTGCAAAAAAGG - Intergenic
936686287 2:114830175-114830197 ATTATCTTCTGGGCAATAACGGG - Intronic
940035548 2:149309174-149309196 ATTAAATTGTAGGGCACAATTGG - Intergenic
940558351 2:155261896-155261918 CTAATACTCTGTGGCATAATTGG - Intergenic
941220065 2:162767124-162767146 ATCATATTCATGGGCATAAATGG + Intronic
943491832 2:188562773-188562795 ACTATATGCTGGGCCATAATGGG + Intronic
944882248 2:204025561-204025583 ATTATATTATTAGGCATAAATGG + Intergenic
1168881028 20:1206205-1206227 ATAATTTTTTGGGGCATAAAGGG - Intronic
1168941421 20:1714685-1714707 ATTCTATTTTGGTGCATATTGGG - Intergenic
1169604817 20:7305424-7305446 ATAATATCCTGTGGCATATTAGG + Intergenic
1171889539 20:30697672-30697694 ATTAAATTCAGGGACATAATAGG - Intergenic
1173722780 20:45273942-45273964 ATTTTATTCTGGGAAATCATTGG - Intergenic
1176609440 21:8865121-8865143 ATTAAATTCAGGGACATAATAGG + Intergenic
1176854328 21:13952993-13953015 ATTAAATTCAGAGACATAATAGG - Intergenic
1177462337 21:21429397-21429419 AGTATATTCTGGGGGATGAGAGG - Intronic
1180359535 22:11874967-11874989 ATTAAATTCAGGGACATAATAGG + Intergenic
1182969767 22:34562815-34562837 ATTATAACCTGCGGCATAAATGG + Intergenic
949223322 3:1662494-1662516 AATATAATCAGGGCCATAATAGG - Intergenic
952709749 3:36417552-36417574 ATTATATTCTGTGGTCAAATAGG - Intronic
955031660 3:55227693-55227715 ATTTTATTCTAGGACATAAAAGG + Intergenic
955058535 3:55476645-55476667 TTTGTATTCTGCGGCATAAAAGG - Intronic
955242889 3:57195099-57195121 ATGATATTCAGGGGGAAAATTGG - Intergenic
956498241 3:69852062-69852084 ATTATATTATGGGACATTAGAGG + Intronic
957615484 3:82520739-82520761 GTCATTTTCTGTGGCATAATTGG + Intergenic
959243930 3:103838188-103838210 CTTTTATTCTGGGGCTTATTGGG - Intergenic
959572168 3:107896411-107896433 ATTATAGTCTCTGACATAATTGG - Intergenic
965421426 3:168463820-168463842 ATTTTATTGTGGGGCATGAAGGG + Intergenic
966555509 3:181255244-181255266 AGTATATGTTGGGGCATAATGGG + Intergenic
970465924 4:16323047-16323069 CTTCTATTCGTGGGCATAATGGG + Intergenic
971614468 4:28769908-28769930 AGTATACTCTTGGACATAATTGG + Intergenic
974858904 4:67496000-67496022 ATGATGTTCTGGGGCTTAAAAGG + Intronic
975059556 4:69980210-69980232 CTAATATTCTGTAGCATAATAGG - Intergenic
977509848 4:97949527-97949549 GTTCTATTCTGGTGCATAATGGG + Intronic
980130913 4:128814940-128814962 ATTACAGTCTGGGGCTAAATGGG - Intronic
982971637 4:161995709-161995731 AATTTATTCAGGGGCATAGTTGG - Intronic
985074404 4:186198760-186198782 ATTATTTTCTGAGGCTTCATGGG + Intronic
1202769802 4_GL000008v2_random:193387-193409 ATTAAATTCAGGGACATAATAGG - Intergenic
987592808 5:19953485-19953507 ATTTTATTCATGGGCATTATTGG + Intronic
990168717 5:53023137-53023159 TTTATACTCTGGGTGATAATAGG + Intronic
990537785 5:56740081-56740103 ATTACATTCTGGAGCCAAATTGG - Intergenic
992167173 5:74065751-74065773 ATTAAATTCTGGAGTATACTGGG - Intergenic
993082721 5:83321530-83321552 AATATTTTCTGTGGCTTAATAGG - Intronic
993082891 5:83324179-83324201 AATATTTTCTGCGGCTTAATAGG - Intronic
993294933 5:86124916-86124938 ATTTTATTCAGGAGCACAATAGG - Intergenic
993351868 5:86859330-86859352 TTTATATTATTGGGCAAAATAGG + Intergenic
993414852 5:87614413-87614435 ATTAAATTCATGGGTATAATTGG + Intergenic
994526601 5:100913634-100913656 TTTATTTTCTGGGGAATAACAGG + Intergenic
994564192 5:101419718-101419740 ATTATTTACTTGGGCATCATTGG + Intergenic
997128220 5:131249996-131250018 AGTTGGTTCTGGGGCATAATGGG + Intronic
997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG + Intronic
998478998 5:142445583-142445605 ATTAGCTTCTGAGGCATAATGGG + Intergenic
999611161 5:153371150-153371172 GTTCTATCCTGGGACATAATAGG + Intergenic
1004713201 6:18191926-18191948 AATAAATTATGGGGCAGAATGGG + Intronic
1004992639 6:21155810-21155832 AATATATTCTGGAGCACATTTGG - Intronic
1005003100 6:21262583-21262605 ATTATTTTCTGGGGCTTGCTTGG + Intergenic
1005099149 6:22150641-22150663 ATTATTTTCTGGGGTATTGTGGG + Intergenic
1008960914 6:57264465-57264487 ATTATATTCTGTGAAATAATGGG - Intergenic
1010264854 6:73854623-73854645 TTGATATATTGGGGCATAATAGG + Intergenic
1011560642 6:88610601-88610623 ATTATGTTCAGGGGCTAAATGGG + Exonic
1017626508 6:156354783-156354805 ATTATATTGCAGGGCATAAAGGG + Intergenic
1018494209 6:164331735-164331757 AATATATTCTGGAACAAAATGGG + Intergenic
1018670520 6:166173166-166173188 ATTTTATTCAGGGCCAAAATAGG - Intergenic
1019079093 6:169416925-169416947 ATCACATTATGGGGCCTAATTGG - Intergenic
1021432225 7:20573032-20573054 GTCATATTCTGAGGCATACTAGG + Intergenic
1021795884 7:24254025-24254047 AGAATCTTCTGGGGCATAAAGGG - Intergenic
1023217288 7:37876666-37876688 ATCATATTCTTGGATATAATAGG + Intronic
1030768644 7:113443859-113443881 TTTATATTCTGAGGCATACAAGG - Intergenic
1031025860 7:116679161-116679183 ATTTTATTCTGGCACATAGTAGG + Intronic
1032710309 7:134455305-134455327 ATTTTATTTTGGGGCAAATTAGG + Intronic
1033241948 7:139687827-139687849 ATAATATTCTGGGGCAGTTTGGG + Intronic
1036803546 8:11810901-11810923 CTTTGATTCTTGGGCATAATGGG + Intronic
1037873001 8:22517217-22517239 ATTATATACTGTGGCTAAATGGG - Intronic
1038456723 8:27676620-27676642 ATTATATTCTTGGTCATCCTGGG - Intronic
1042856099 8:73269222-73269244 ATTATATTATGAGACATAAAGGG - Intergenic
1042927527 8:73981262-73981284 ATCATATTCTATGGCATCATGGG + Exonic
1043773408 8:84233732-84233754 ATCATATTCTGGGGTCTCATGGG + Intronic
1046629738 8:116611697-116611719 AATATATTCCAGGGCATAAAAGG + Intergenic
1047575692 8:126152105-126152127 ACTATATTCTGAGGCATAAATGG + Intergenic
1048199277 8:132358309-132358331 AACATATTCTGAGGCCTAATGGG + Intronic
1048217367 8:132508684-132508706 ATTAAAGTCTGGGCCATGATAGG - Intergenic
1050981960 9:12030772-12030794 ATAATAATCTGGTGCATCATAGG - Intergenic
1053658883 9:40249607-40249629 ATTAAATTGAGGGACATAATAGG + Intronic
1054359923 9:64102292-64102314 ATTAAATTCAGGTACATAATAGG + Intergenic
1054371003 9:64395897-64395919 ATTAAATTGAGGGACATAATAGG + Intronic
1054525715 9:66126615-66126637 ATTAAATTGAGGGACATAATAGG - Intronic
1054678634 9:67885626-67885648 ATTAAATTGAGGGACATAATAGG + Intronic
1203694703 Un_GL000214v1:87103-87125 ATTAAATTCAGGGACATAATAGG - Intergenic
1203559157 Un_KI270744v1:35482-35504 ATTAAATTCAGGGACATAATAGG - Intergenic
1203641570 Un_KI270751v1:16960-16982 ATTAAATTCAGGGACATAATAGG + Intergenic
1193825765 X:86224289-86224311 AATATATTCAGGAGCATCATGGG + Intronic
1193917594 X:87384048-87384070 ATTATATTCTGGGGAACAGGTGG - Intergenic
1193961695 X:87933793-87933815 ATTTTATTTAAGGGCATAATTGG - Intergenic
1194011750 X:88570170-88570192 ATTAAATTGAGAGGCATAATGGG + Intergenic
1196021990 X:111000160-111000182 ATTATGTTCTGTGGGATATTAGG - Intronic
1196461156 X:115933099-115933121 ATTATATTCAGTGGTATTATTGG + Intergenic
1197345330 X:125321770-125321792 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345342 X:125321833-125321855 ATCATGTTCTGGGGCATCACTGG - Intergenic
1199994244 X:153009994-153010016 ATTATATTCTATGGTAAAATTGG - Intergenic
1200274419 X:154718247-154718269 TTTTTATTCTAAGGCATAATTGG - Intronic