ID: 997976853

View in Genome Browser
Species Human (GRCh38)
Location 5:138445941-138445963
Sequence CTGTGGGGGTTGAGGGTAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 548}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997976835_997976853 27 Left 997976835 5:138445891-138445913 CCAGTGGCCACTCTTCTGGAAGG 0: 1
1: 1
2: 1
3: 24
4: 289
Right 997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG 0: 1
1: 0
2: 5
3: 57
4: 548
997976839_997976853 20 Left 997976839 5:138445898-138445920 CCACTCTTCTGGAAGGGGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 213
Right 997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG 0: 1
1: 0
2: 5
3: 57
4: 548
997976834_997976853 28 Left 997976834 5:138445890-138445912 CCCAGTGGCCACTCTTCTGGAAG 0: 1
1: 1
2: 2
3: 18
4: 185
Right 997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG 0: 1
1: 0
2: 5
3: 57
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997976853 Original CRISPR CTGTGGGGGTTGAGGGTAGA GGG Exonic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901133521 1:6978018-6978040 ACGTGGAGGTAGAGGGTAGAAGG + Intronic
902769538 1:18637680-18637702 CTGTGGGGGCTGGGCGTAGATGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902789444 1:18756713-18756735 GTGTGGGGGTGAGGGGTAGATGG + Intergenic
902856850 1:19213193-19213215 CTTTGGGGGATCTGGGTAGAGGG + Intergenic
903319542 1:22534119-22534141 CTGTGGGGGTTTTGGTTAGTTGG + Intergenic
903370082 1:22829703-22829725 CTGTGGGGGTTGGGGATGGTGGG + Intronic
903539682 1:24089947-24089969 GTGTGGGGGATGAGGGCAGGTGG - Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904927344 1:34059371-34059393 ATGAGGGGGCTGAGGGAAGAGGG - Intronic
904940445 1:34162291-34162313 CTAAAGGGGTTGAGGGGAGAAGG + Intronic
905212713 1:36385670-36385692 GGGTGGGGGTTGCGGGTAGGCGG - Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906727492 1:48054729-48054751 CTGTGGGAGCTGGGGGTCGAGGG + Intergenic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
907999372 1:59665610-59665632 TTAGGGGGGTTGGGGGTAGAGGG - Intronic
908137337 1:61146715-61146737 ATGTGGGGGTGGAGGGTATGGGG - Intronic
908204549 1:61832170-61832192 ACTTGGGGGTAGAGGGTAGAAGG + Intronic
908510566 1:64847291-64847313 AGGTGGGGGTTGGGGGTGGAAGG + Intronic
908689872 1:66766981-66767003 ACGTGAGGGTTGAGGGTGGAAGG + Intronic
909046987 1:70722378-70722400 CTGTTGGGAGTGAGGGTGGAGGG - Intergenic
909624438 1:77700037-77700059 TGGTGGGGGTTGAGGGATGAGGG + Intronic
909854846 1:80515904-80515926 GTGTGGGGGATGAGGGGTGAGGG - Intergenic
909881082 1:80879651-80879673 CTATGGGGGTTGAGGGATGGAGG - Intergenic
910241088 1:85086941-85086963 CTGTGGGAGATTAGGGCAGAGGG - Intronic
910644424 1:89498076-89498098 GTGTAGGGGTGGAGGGTGGATGG + Intergenic
911550176 1:99269072-99269094 CTGTGGGGGTTGGGGGGCTAGGG - Intronic
911551466 1:99287034-99287056 TGTTGGGGGTTGAGGGTTGAGGG - Intronic
912496334 1:110094492-110094514 CAGAGGGGGTTGGGGGTAAATGG - Intergenic
912630627 1:111243779-111243801 TGTTGGAGGTTGAGGGTAGAGGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912750603 1:112284043-112284065 TTGAGGGGGTTGAAGGGAGAGGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914688852 1:150007550-150007572 CTCTTGGGGTTGAGGGTGGATGG - Intronic
914917985 1:151830094-151830116 ATGTGGGGGTTGGGAGTAGGGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916833219 1:168514135-168514157 CTGTTGGTGTTATGGGTAGATGG + Intergenic
917107240 1:171504723-171504745 CTGGCGGGGTGGAGGGTAGGGGG + Intronic
918978652 1:191525736-191525758 GTGTAGGGGTAGAGGGTATATGG + Intergenic
918988950 1:191672415-191672437 GTGGTGGGGTTGGGGGTAGAAGG - Intergenic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920344267 1:205295833-205295855 ATGTGGGGGTTGTTGCTAGAAGG - Intergenic
920769030 1:208863023-208863045 CTCTGGGGGTTCGGGGAAGAAGG + Intergenic
921009025 1:211122820-211122842 CTGTTGGGGGTGGGGGTAGAAGG + Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922932632 1:229402375-229402397 TTGTGGGGGATGAGAGTAGACGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
924109280 1:240681939-240681961 CTGTCGGGGTTGAGGGTGGGAGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924421599 1:243915016-243915038 CTGTGGGGGCTGAGGGACCAAGG - Intergenic
1062804931 10:411524-411546 ATTTGGGGGTTGAGGGGAAACGG + Intronic
1062890719 10:1057318-1057340 CTGGAGGGGTTGGGGGCAGAAGG + Intronic
1063361055 10:5459217-5459239 TTGTGGGGCGTCAGGGTAGAGGG + Intergenic
1063667089 10:8069161-8069183 CTTTGTGGGTTGAGGGTAGGAGG + Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071484331 10:86088596-86088618 CTTTGGGGGTTCATGGTTGAGGG + Intronic
1071816078 10:89233859-89233881 TTGTGGGGGGTGGGGGTAAATGG - Intronic
1072003410 10:91220133-91220155 TTGTGGAGGTTGAGGGTGGGGGG - Exonic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1074390927 10:113057524-113057546 CTGTTGGGGGTCAGGGTATAGGG + Intronic
1074716358 10:116223162-116223184 CTGGGGGGCTAGTGGGTAGAGGG - Intronic
1074746184 10:116534850-116534872 ATTTGAGGGTGGAGGGTAGAAGG - Intergenic
1074979408 10:118607824-118607846 CTGTGGAGGTTTTGGGGAGAAGG - Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076481901 10:130790244-130790266 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481908 10:130790296-130790318 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481921 10:130790400-130790422 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076731998 10:132443918-132443940 GAGTGGGGGTTGAGAGGAGAGGG - Intergenic
1077017688 11:404222-404244 CTGTCGGGGCTGAGGGTGGAGGG - Exonic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077307003 11:1872968-1872990 CGGTGGGGGGTGGGGGTATAGGG + Intronic
1077504217 11:2922674-2922696 CTGTGTGGGTTGAGTGGAGTGGG + Intronic
1077863072 11:6200091-6200113 ATGAGGGGGTTGAGGGCAGGTGG - Exonic
1078173439 11:8949032-8949054 GTGTGTGTGTTGAGGGTACAGGG - Intronic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080555011 11:33407869-33407891 ATGTGGGGGTTGAGGATGAAAGG - Intergenic
1081294517 11:41369374-41369396 CTAAGAGGGTGGAGGGTAGAGGG + Intronic
1081732742 11:45383157-45383179 ATTTGGGGGTTGAGGGCAGTTGG - Intergenic
1081994161 11:47352867-47352889 CTGCGGGGGGTGAGGGGGGAAGG - Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083328268 11:61884745-61884767 GTGTGGGGGTTGGGGGGACAGGG - Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083801492 11:65048657-65048679 AGGCGGGGGTTGAGGGTGGAGGG - Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084468108 11:69339161-69339183 CTGTGGGGGAAGAGGGTGGGTGG - Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085638399 11:78175659-78175681 CTGTGGGCCTTGAAGATAGATGG - Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1087395294 11:97589344-97589366 TGGTGGGGGATGAGGGTATATGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1090325389 11:125881913-125881935 CTGTGGTGGTTTAGGCTAGGAGG - Intergenic
1090349882 11:126101192-126101214 CTGGTGGGGTTGAGGGGAGTTGG + Intergenic
1090874456 11:130776425-130776447 CTCTGTGTGTTGAGGGTACAAGG + Intergenic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1093863274 12:24194260-24194282 CTGTGGGGGGTGATGGAAGGTGG + Intergenic
1095050589 12:37550830-37550852 CTGCAGGGGTTTGGGGTAGATGG + Intergenic
1095370002 12:41455929-41455951 ATGTGGTGGTTGAGGGGACAGGG - Intronic
1096406433 12:51347302-51347324 CTGAGGGCTATGAGGGTAGATGG + Intergenic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1098130395 12:67344336-67344358 CTTGGGAGGTTGAGGGTGGAAGG - Intergenic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1099572124 12:84335726-84335748 ATGTGGGGGTTGAAGCTAGAGGG + Intergenic
1100264771 12:92965277-92965299 GTGTGGGGGTTAAGGGGAGGGGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101937424 12:109069653-109069675 CAGTGGGGGATGAGGATAGCAGG + Intronic
1102198670 12:111042443-111042465 CTTTGGGGGTGGAGGGTGTAGGG - Intronic
1102344835 12:112152947-112152969 CTGTGGGGGTTTGGGTTTGAGGG + Exonic
1102555491 12:113724004-113724026 CTCTGGGGGTTGTGGGGAGGTGG + Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1109993350 13:70087911-70087933 CTGTTGGGGTTGGGGGCATAGGG + Intronic
1110422524 13:75329102-75329124 GTGTGGGGGTTGGGGGGAGGTGG - Intronic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1112732334 13:102378289-102378311 CTGTGGGGGCAAAGGGTATAAGG + Intronic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1114438287 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG + Intergenic
1114452712 14:22837436-22837458 AGGTGGGGGTCGAGGGTGGACGG + Intronic
1114529790 14:23388550-23388572 GTGTGGGGGGTGAGGGCAGGGGG - Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1117160155 14:52981587-52981609 ATGTGGGGGTGGAGGGTATATGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117614604 14:57520721-57520743 CTGTTGGGGGTGGGGGGAGATGG - Intergenic
1119071351 14:71588061-71588083 CTCCGGGGGTTGAGGTTATATGG - Exonic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1120776266 14:88440984-88441006 CTTTGGGGGCTGAGGGGAAAGGG - Intronic
1121300087 14:92863084-92863106 CTGTGAGGGGTGAGGATAAAAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1124365586 15:29069021-29069043 CTGTGGGGGCTGGGGGCGGAGGG - Intronic
1124807831 15:32904314-32904336 CTGTGGGGGAAGTGAGTAGAAGG + Intronic
1124893095 15:33750868-33750890 CTGTGGGGGTTGTGGGGGTAGGG - Intronic
1124963438 15:34415236-34415258 TTGTGGGGGCTGCGGGGAGAGGG - Intronic
1124980059 15:34561462-34561484 TTGTGGGGGCTGCGGGGAGAGGG - Intronic
1125056956 15:35371446-35371468 GTGTGGAGGTAGAGGGTATATGG + Exonic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1129037926 15:72662186-72662208 TTGAGGGGGATGTGGGTAGAGGG + Intronic
1129211963 15:74075045-74075067 TTGAGGGGGATGTGGGTAGAGGG - Intronic
1129398440 15:75266039-75266061 TTGAGGGGGATGTGGGTAGAGGG + Intronic
1129402048 15:75290315-75290337 TTGAGGGGGATGTGGGTAGAGGG + Intronic
1132699455 16:1216132-1216154 CCGTGGGGGTTGGGGGTGGCTGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132892358 16:2210552-2210574 CTGTGGGGGTTGTGGCTGGAGGG - Exonic
1132977684 16:2718869-2718891 CTGTGGGGGCTGATGGGAAATGG + Intronic
1133569285 16:7025626-7025648 CTGGGGGGGTTTTGGATAGAGGG + Intronic
1134405713 16:13956769-13956791 TTGTGGGGGATGGGGGTGGAGGG + Intergenic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1136011663 16:27367388-27367410 TTGTGGGGGATGAGGGGAGGGGG + Intergenic
1136043525 16:27598807-27598829 CTGTGAGGGGTAAGGGTAGCAGG + Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137954346 16:52813920-52813942 CTGTGGGGGGTGAGGTTAGTGGG + Intergenic
1138306671 16:55983170-55983192 TTGTGGGGGCAGAGGGTATATGG - Intergenic
1138485037 16:57335456-57335478 CTGTGGGGGATGAGGGAATGGGG - Intergenic
1138565798 16:57831919-57831941 CTTTGGGGGTTGAGGGGAAAGGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1141613308 16:85196170-85196192 ACTTGGGGGTTGTGGGTAGAGGG + Intergenic
1141721149 16:85756045-85756067 CTGTGGGGGGCGGGGATAGAGGG - Intergenic
1142124541 16:88403632-88403654 CTGTGGGGGCCGAGGGCAGGAGG - Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143216294 17:5227656-5227678 GTGTGGGGGTTGAGGTGGGAGGG + Intronic
1144472227 17:15554715-15554737 CTGAGGGGTTTGAAGGTAAATGG - Intronic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1144924247 17:18789982-18790004 CTGAGGGGTTTGAAGGTAAATGG + Intronic
1145772609 17:27504464-27504486 CTGTGGGGTTTGAGGGTTCCGGG + Intronic
1146532437 17:33620868-33620890 CTGTGGGGGCTGGGGGTGCATGG - Intronic
1146913569 17:36663824-36663846 ATGTGGGGTTTGTGGGTAGGTGG + Intergenic
1146954378 17:36928632-36928654 CTGGGGAGGTTGATGGTACAAGG - Intergenic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148110620 17:45143210-45143232 CTGGCGGGGCTGCGGGTAGAGGG - Intronic
1148645869 17:49219471-49219493 CTCTTGGGGATGAGGGTGGAGGG + Intronic
1148718837 17:49736006-49736028 CTCTGGGTGTTGAGAGTTGAGGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148749388 17:49935773-49935795 GTGTGGGGGATGCGGGTGGAGGG + Intergenic
1148967104 17:51445300-51445322 CTTTGAGGGTGGAGGGTAGGAGG + Intergenic
1150569112 17:66370153-66370175 CTGTGGAGGTTGAGGGGATGTGG - Intronic
1151361956 17:73594253-73594275 CTGAGGGGGTCAAGGGTCGAGGG - Intronic
1151518675 17:74613530-74613552 CTGTGGGGTCTGTGGGGAGATGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152780975 17:82227312-82227334 CGGTGGGGGTTCAGGGTTCAGGG + Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153921027 18:9790226-9790248 TTGTGGGGGTAGGGGGTACAGGG + Intronic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155558851 18:27052916-27052938 CTGTTGGGGGTGAGGGGAAAGGG + Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156352356 18:36311996-36312018 CTGGGAGGCTTGAGGGTTGAAGG - Intronic
1157332170 18:46712025-46712047 GGGTGGGGGTTGGGGGTAGCAGG + Intronic
1157605528 18:48923684-48923706 TAGTGGGGGTTGGGGGTTGAGGG - Intronic
1159934300 18:74350068-74350090 CTGTGGGGTGTGGGGGTAGGAGG + Intronic
1161258846 19:3324535-3324557 CTGTGAGGGGTGAGAGCAGAGGG - Intergenic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161477891 19:4496458-4496480 CTGTGAGGGGTGAGGGTTGTGGG - Intronic
1161669675 19:5599178-5599200 CTGTGTGGGTTTAGAGTGGAGGG - Intronic
1161807983 19:6456146-6456168 GTGTGGGGGTTGCGGGTACAGGG - Intronic
1162375070 19:10300028-10300050 CTGTTGGGGATGAGGGGGGAAGG - Intergenic
1162745203 19:12793966-12793988 CTGGAGGGGGTGGGGGTAGAGGG - Intronic
1162751674 19:12833553-12833575 CTCTGGGGGATGAATGTAGAGGG + Intronic
1163290527 19:16376669-16376691 CTGTTGGGGGTGAGGGTGGCAGG - Intronic
1163678414 19:18666970-18666992 CTGTCGGGGGTGCGGTTAGAGGG - Intronic
1163741250 19:19014390-19014412 TTGTGGGGTGTGAGGGTGGAAGG + Intronic
1163741706 19:19018102-19018124 TTGTGGGGTGTGAGGGTGGAAGG - Intronic
1164482160 19:28620229-28620251 CTCTGGGAGTTGAGGGTGGGAGG - Intergenic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1166975537 19:46603078-46603100 CTGTGGGTGTTGTGGGTGGCAGG - Intronic
1166988469 19:46676651-46676673 CTGTGGGTGTTGACGGGAGCAGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167642119 19:50687709-50687731 CTGTGGTGGTAGAGGGTGGTGGG - Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
925521768 2:4754430-4754452 TTGTGGGGGTTGAGGGGGGAAGG + Intergenic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
926956494 2:18306880-18306902 CTGTGGGGGATGTTGGTAGTTGG - Intronic
927758359 2:25727102-25727124 CTGTTGGGGTCGGGGGCAGAGGG - Intergenic
927834642 2:26383980-26384002 CTGTCTGGGTTGCGGGGAGAAGG + Intronic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
929272678 2:39990105-39990127 CTGTAGGGGTTGAAGGAAGCAGG + Intergenic
929384890 2:41394748-41394770 ATGTGGGGGGCTAGGGTAGAAGG + Intergenic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932487562 2:72093845-72093867 CTCAGGGGGCTGTGGGTAGAGGG - Intergenic
932566508 2:72914559-72914581 TTGTGGGGGATGGTGGTAGAGGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932873273 2:75425229-75425251 CTCTGGGGCTTCAGGGTCGAGGG - Intergenic
933727463 2:85434966-85434988 CTGCGGGGGTGGGGGGTAGGAGG - Exonic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
935124269 2:100209185-100209207 CTGGAAGGGTAGAGGGTAGAAGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936793611 2:116181768-116181790 TAGTGAGGGTTGCGGGTAGAAGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937347065 2:121132601-121132623 CTGTGGGGGTTGGGGGTGCAGGG + Intergenic
937831488 2:126429330-126429352 CTGTGGGGGCTGGGGGTGCAGGG - Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
939495774 2:142926124-142926146 CTGTGGGGGGTGAGGGGCTAAGG + Intronic
939858509 2:147390005-147390027 CTGTGGGGGCTGGGGGTTGGGGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941082672 2:161079881-161079903 CTTTGGCGGTTGAGACTAGAAGG + Intergenic
942074651 2:172345530-172345552 CTCGGGGGGCTGAGGGCAGAAGG + Intergenic
942425977 2:175861284-175861306 TTGTGGGGGTTGAGGGGAGTTGG + Intergenic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
942824107 2:180153306-180153328 CTTGAGGGCTTGAGGGTAGAAGG - Intergenic
943451129 2:188043730-188043752 CTGTTGGGGGTGAGGGGTGAGGG + Intergenic
944119672 2:196227551-196227573 CTGGGGGCATTGATGGTAGAAGG - Intronic
944154370 2:196594362-196594384 TTCTGGGGGTTGAGGGTGGGAGG - Intergenic
944955856 2:204807844-204807866 TTGTGGGGGTTGGGGGTAGTGGG + Intronic
946264315 2:218525373-218525395 CTGGGGGGGTTGTGGGTGGGAGG + Intronic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947811165 2:233004732-233004754 CGATGGGGGGTGAGGGGAGAGGG - Intronic
947862217 2:233368672-233368694 GTGTGGGGGTTTAGGGTTGGGGG - Intronic
948016992 2:234699194-234699216 CTTTTGGGGTTGGGGGAAGAAGG + Intergenic
948021308 2:234735977-234735999 CTGCAGGGGTTGAGGGTTGTAGG - Intergenic
948964601 2:241367954-241367976 ATGTGGGGGTGGAGGGTATATGG - Intronic
1168770077 20:408891-408913 CTGATGGGGAGGAGGGTAGAGGG - Intronic
1168834941 20:871717-871739 CTGGGGGAGTTGAGGTTACAGGG + Exonic
1170967363 20:21085952-21085974 CTGTGGGTCTTGAGGGTTAAAGG - Intergenic
1171054688 20:21895162-21895184 CCTTGGGGGTTGAGCTTAGATGG + Intergenic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1171545100 20:25994303-25994325 CTGCAGGGGTTTGGGGTAGATGG + Intergenic
1172101056 20:32484034-32484056 CGGTGGGGGCTGGGGGGAGAGGG + Intronic
1172240630 20:33410330-33410352 GTCTGGGGGTTGGGGGCAGAGGG + Exonic
1172547474 20:35772679-35772701 CTTTGGGGGCTGACGGAAGAGGG - Intronic
1173038481 20:39436023-39436045 AAGTGGGGGGTGAGGGGAGAGGG - Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1174308986 20:49635762-49635784 GGGTGGGGATTGAGGGTGGAGGG - Exonic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175288911 20:57860207-57860229 CTTTAGGGGTTGAGGGTCTATGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175934568 20:62509107-62509129 GTGTTGGGGTGGAGGGTTGAGGG - Intergenic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1176924200 21:14727107-14727129 CTCTGGGGGTTGTGGGGAGTGGG - Intergenic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177512965 21:22113999-22114021 CTGTGGGGGTTGGGTGGTGAGGG + Intergenic
1177782907 21:25639561-25639583 GTGTGGGGGTAGGGGCTAGAGGG - Exonic
1178208390 21:30497609-30497631 CTTTGGGGGTCGAGGGAGGAGGG - Intergenic
1178753797 21:35328623-35328645 CTGTGGGAGTTGGGGGTTGAGGG + Intronic
1178989540 21:37341376-37341398 CTGCTGGGTTTGAGGGTGGAGGG - Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1181149045 22:20869767-20869789 CGGTTGGGGGTGAGGGGAGATGG - Intronic
1181619889 22:24083652-24083674 CTCTGGAGGGTGAGGGTAGGAGG + Intronic
1181759674 22:25049464-25049486 CTGACGGGGTTGAGGGCAGCAGG + Intronic
1181910737 22:26236205-26236227 CTTTGGAGTTTGAGGGCAGATGG + Intronic
1182146572 22:28000457-28000479 CTGTGGGGTATTAGGGCAGATGG + Intronic
1182645434 22:31805162-31805184 CTGTGGGAGTTGGGAATAGAAGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183608506 22:38881851-38881873 GTGTGCAGGTTGAGGGTACAGGG - Intergenic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184829512 22:46975256-46975278 CACTCGGGGTGGAGGGTAGACGG + Intronic
1185256978 22:49839472-49839494 GTGTGGGGAATGAGGGTAGGCGG + Intergenic
950126170 3:10511061-10511083 CTGTGGGGTCTGAGGGTAATGGG - Intronic
951035802 3:17930621-17930643 GGGTGGGAGGTGAGGGTAGAGGG + Intronic
951512702 3:23521882-23521904 CTGGGGGGGTGGGGGGTACACGG - Intronic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
952123531 3:30273390-30273412 CTGGGAGGGTTGAGGGTGGGGGG - Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
952903085 3:38122255-38122277 ATGTGGGGGCTGAGGTTAGGAGG - Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
955018368 3:55093915-55093937 CTGGGGGGGTAGGGGGTAGGAGG - Intergenic
955095737 3:55796067-55796089 TTGTGGTGGTTGAGGGGGGAGGG + Intronic
955376114 3:58398546-58398568 CTGCGGGGGCTGAGGGGAGCTGG + Intronic
955588303 3:60506252-60506274 CTTTGAGGGTGGAGGGTAGGTGG + Intronic
955846080 3:63164324-63164346 ATTTGAGGGTAGAGGGTAGAAGG + Intergenic
955939293 3:64132730-64132752 TGGCTGGGGTTGAGGGTAGATGG + Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956495464 3:69821370-69821392 CTTAGGGGGTTGGGGGTGGAGGG - Intronic
956578030 3:70777441-70777463 CCTTGAGGGTGGAGGGTAGAAGG + Intergenic
956973440 3:74553082-74553104 CTGTGGGGGTTGGGGGGCTAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958962309 3:100522090-100522112 CTGTTGGGGGTGGGGGTAGTGGG + Intronic
959168704 3:102816830-102816852 GTGTGGGGGTAGAGGATACATGG - Intergenic
959453256 3:106528733-106528755 CTTTGGGGGTTGGGGGGTGAGGG + Intergenic
959502152 3:107119024-107119046 CGGTGGGGGTTGGGGGTAGGGGG - Intergenic
959991761 3:112638858-112638880 CTCTGGGGGTTGAGGGAGGTTGG + Exonic
961218129 3:125177640-125177662 CTATGGGGGTTAGGGGGAGATGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961872634 3:129999902-129999924 TTGGGGGGGTGGAGGGTGGAGGG - Intergenic
962411440 3:135144627-135144649 AGGTGGGGGTTGAGGGTTGGTGG - Intronic
962455700 3:135563741-135563763 CTGAGAGGGTTGATGGTAGAGGG - Intergenic
963171557 3:142256507-142256529 CTGTGGGGGTTGCTGCTAGCTGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964311184 3:155394903-155394925 CTGTGGGGAGTGGGGGTCGAGGG - Intronic
965110967 3:164421660-164421682 TTTTGGGGGTGGAGGGTAAAGGG - Intergenic
967080314 3:186043730-186043752 CTTAGGGGGTTGAGGGCACATGG - Intergenic
967214480 3:187198931-187198953 CTGTGGGGGCTGAGTGGGGAGGG + Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968950382 4:3688460-3688482 CTGTGGTGGGTGATGGGAGAGGG + Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
969871166 4:10106088-10106110 CTGCTGGGGGTGAGGGTGGAAGG + Intronic
970250704 4:14112752-14112774 CTGTTGGGGGTGGGGGTTGAGGG - Intergenic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
971454120 4:26828002-26828024 CTATGGGGTTAAAGGGTAGATGG + Intergenic
972355043 4:38272610-38272632 GTGTGGGGGTAGAGGGCATATGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
975880001 4:78893805-78893827 CTCTGGAGGTTGAGGTGAGAGGG - Intronic
976751925 4:88457568-88457590 CTGTGAGGGGTGAGGGCTGAGGG + Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977573848 4:98657500-98657522 CAGTGGGGGTGCGGGGTAGAGGG - Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
979402853 4:120271790-120271812 CAATGTGGGGTGAGGGTAGAAGG - Intergenic
979578937 4:122332777-122332799 CTGTGGGGGGTGGGGGGAGGGGG - Intronic
979776572 4:124596023-124596045 CTGTGGGGGTTGGAGGGAGCAGG + Intergenic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
982565030 4:156975310-156975332 CTGCTGAGGCTGAGGGTAGAGGG + Intergenic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
983968852 4:173846394-173846416 ATGTGGAGGGTGGGGGTAGAAGG + Intergenic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
984326588 4:178262077-178262099 CTGTGGAGGTTATGGGGAGAAGG + Intergenic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
986551653 5:8962758-8962780 CTGTGGGGTTTGGGGGGATAGGG - Intergenic
986806189 5:11311063-11311085 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806214 5:11311225-11311247 ATGTGTGGGTTGAGGGTGCATGG - Intronic
986806270 5:11311568-11311590 ATGTGTGGGTTGAGGGTGCATGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987518250 5:18943952-18943974 GTGTGGGGGTTGTGGGTGGCGGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988352364 5:30126751-30126773 ATGTGGGGGCAGAGGGTATATGG - Intergenic
988658367 5:33237342-33237364 CAGTGCAGGTTGAGAGTAGAAGG + Intergenic
988699148 5:33655804-33655826 CTGTCGGGGTTCAGGGGAAAGGG - Intronic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
990582136 5:57174783-57174805 CTGAGGGGGTGGAAGGTACAGGG - Intronic
990688985 5:58340918-58340940 ATGTTGAGGTTCAGGGTAGAAGG + Intergenic
990970246 5:61497994-61498016 CTGTGGGGGTCTAGGGATGAGGG + Intronic
993335955 5:86659195-86659217 TGTCGGGGGTTGAGGGTAGAGGG - Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994685974 5:102952865-102952887 ATGTGTGGGTTGGAGGTAGATGG - Intronic
995506600 5:112866906-112866928 CTGTTGGGGGTGAAGGTAGCTGG + Intronic
995734545 5:115285946-115285968 TTGTGGGGGATGAGGGGAAAAGG + Intronic
997841307 5:137242729-137242751 TTTTGGGGGTTGGGGGTACAGGG - Intronic
997883261 5:137609384-137609406 CTGTGGGGTTTCAGGGTGGGGGG + Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998391254 5:141788406-141788428 CTGTTAGGGTAGAGGGGAGAAGG - Intergenic
998637339 5:143970835-143970857 CTCTCTGGGTTGAGGGGAGAGGG + Intergenic
999056824 5:148587037-148587059 CAGTGGGGGTTCAGGGGAGCTGG - Intronic
999471710 5:151860407-151860429 GTATTGGGGTTGAGGGTAAAAGG - Intronic
999918415 5:156289454-156289476 CTGTGGGGGGTGAGGGGTGGAGG - Intronic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001407053 5:171483778-171483800 GTGTGGGGGTTGGGGATAGGTGG + Intergenic
1001963562 5:175894917-175894939 CTGTGGGAGTTGTGTGTTGAGGG - Intergenic
1002077153 5:176715073-176715095 CTGTGGGCCTTGGCGGTAGAAGG + Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1003815525 6:9836125-9836147 CTGTCGGGGGTGCGGGGAGAGGG - Intronic
1003943242 6:11049248-11049270 CTGTCGGGGTTGGGGGGTGATGG - Intergenic
1004190634 6:13460659-13460681 CTGTTGGGGGTGTGGGGAGAGGG + Intronic
1004516640 6:16327070-16327092 CTTTTGTCGTTGAGGGTAGAAGG + Exonic
1004797364 6:19102778-19102800 GGGTGGGGGTTGGGGGTGGAGGG - Intergenic
1006433846 6:34015661-34015683 CGGTGGGGGTTGTTGGTGGAGGG - Intergenic
1006641336 6:35491259-35491281 CGGTGGGGGGTGAAGGGAGAAGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006901811 6:37507713-37507735 TGGTGGGGGGTGGGGGTAGATGG + Intergenic
1007421766 6:41723948-41723970 CTGTGGGGCTTCTGGCTAGAAGG - Intronic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1010486413 6:76419837-76419859 GTGTGGGGGTTGAGGTGAGGAGG + Intergenic
1011176098 6:84562172-84562194 GTGTGGTGGTAGAGAGTAGAAGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012995206 6:105965828-105965850 CGGTGAGGGTTGAGGCAAGAGGG + Intergenic
1013007015 6:106083209-106083231 GTGTGGGGGGTGAGGGTGGGTGG + Intergenic
1013626624 6:111943985-111944007 CTGAGGGGGTTGAAAGCAGAAGG + Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015243559 6:131052841-131052863 CTGTAGGGGGTGAGGTTAGCAGG - Intronic
1015635434 6:135269844-135269866 CTCTGGGAGTTGAGTGTAGTGGG + Intergenic
1016222653 6:141693833-141693855 CTGTGGGGGAAGACGGTATATGG + Intergenic
1016380204 6:143469953-143469975 TTCTGGGGGGTGAGGGGAGATGG + Intronic
1018153722 6:160965507-160965529 CTTGGGGGGTTGGGGGAAGATGG - Intergenic
1018191336 6:161311632-161311654 GTATGGGGGTTGAGGTTTGAGGG - Intergenic
1018672155 6:166188123-166188145 CTGTTGGGGGTGGGGGTAGTGGG + Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019060585 6:169254838-169254860 AGGTGGGGGTTGATGGTACATGG + Intergenic
1019112980 6:169732435-169732457 CTGTTGGGGGTGAGAGTGGAGGG - Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019613768 7:1949614-1949636 CTGTGGGGTTTCAGGGGAGGTGG - Intronic
1019692680 7:2425423-2425445 TTTTGGGGGTGGAGGGTAAAAGG - Intronic
1020278050 7:6636788-6636810 CTGTGGCGGTTGAGTGCAGGAGG - Intergenic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1020810538 7:12845553-12845575 CTCTGGGGGTTGAGGGACTAGGG + Intergenic
1020888466 7:13849376-13849398 CTCTGGGGGGTGATGGGAGAGGG + Intergenic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1022030606 7:26488460-26488482 CTGGGTGGGTTGGGGGAAGAAGG + Intergenic
1022316010 7:29246303-29246325 CTGGGAGGGTTGGGGGTAGGTGG + Intronic
1022444377 7:30457730-30457752 CTGTGGGGTTTGGTGGGAGACGG + Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1023965272 7:44960853-44960875 CTGAGGGGGCTGAGGGCTGAGGG + Intergenic
1023965401 7:44961251-44961273 CTGAGGGAGCTGAGGGTTGAGGG + Intergenic
1023965486 7:44961482-44961504 CTGAGGGGGTTAAGGGCTGAGGG + Intergenic
1023965553 7:44961674-44961696 CTGAGGGGGCTGAGGGCTGAGGG + Intergenic
1024604640 7:51013653-51013675 CTGTGGGGGACGAGGGGAGGAGG - Intergenic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026982133 7:74532992-74533014 CTGGTGGGGCTGAGGTTAGAAGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027113220 7:75457379-75457401 TTGTGGGGGTTGGGGGATGAAGG - Intronic
1027131921 7:75597317-75597339 CTCTAGGGGTTGAGGCTAGAAGG + Intronic
1027178541 7:75921109-75921131 TTGTGGAGGTTTCGGGTAGATGG - Intronic
1027285470 7:76641974-76641996 TTGTGGGGGTTGGGGGATGAAGG - Intergenic
1027956357 7:84883562-84883584 ATCTGAGGGTGGAGGGTAGAAGG - Intergenic
1028641247 7:93044051-93044073 GATTGGGGGTTGGGGGTAGACGG + Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029744039 7:102506869-102506891 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029762029 7:102606032-102606054 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029970700 7:104785937-104785959 ATTTGGGGGTTCAGGGAAGAAGG - Intronic
1030652176 7:112128022-112128044 CTGTCGGGGGTGAGGGTGGAGGG + Intronic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1032177147 7:129640117-129640139 ATGGTGGGGTTGAGGGTTGAGGG + Intronic
1032290262 7:130583341-130583363 CTGTGGGGGGTGGGGGGAGTGGG + Intronic
1033022653 7:137742229-137742251 GGGTGGGGGTTGGGGGTGGAAGG - Intronic
1033425011 7:141236158-141236180 ATCTGGAGGTAGAGGGTAGAGGG + Intronic
1033789400 7:144773447-144773469 CTGTGGGTGGTCAAGGTAGAAGG + Intronic
1034036226 7:147825866-147825888 GTGTGGGTGTTGAAGATAGAAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034956323 7:155337610-155337632 CTGAGGGGGTAGAGCATAGAGGG + Intergenic
1035357397 7:158284696-158284718 CTGCGGGAGGTGTGGGTAGAGGG - Intronic
1035659268 8:1334580-1334602 CTGGGGGGGTCGAGGGCAGGTGG - Intergenic
1036627609 8:10484419-10484441 CTGTGGGGACTGAGTATAGAAGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037710702 8:21353274-21353296 CTCTGAGGGATGAGGATAGATGG - Intergenic
1038126932 8:24685121-24685143 CTGTGGGGGGTGGGGGGAGGGGG + Intergenic
1038127539 8:24691342-24691364 GTGTGGGGGTGGAGGGTCGGGGG - Intergenic
1038349739 8:26765150-26765172 TTGTGGGGTTTGGGGTTAGAGGG - Intronic
1038382198 8:27106488-27106510 GTGTGGGGGTTAGGGGTATATGG - Intergenic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1040539539 8:48339995-48340017 ATGAGGGGGTGGAGGCTAGATGG - Intergenic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1042699648 8:71598243-71598265 CAGGTGGGGTTGAGGGTAGAGGG + Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042855084 8:73258736-73258758 CTCAGGAGGCTGAGGGTAGAAGG - Intronic
1047581686 8:126223323-126223345 CTCTGGGGCTTCAGGGTAGTGGG - Intergenic
1047715601 8:127592257-127592279 TTGTGGGGGCTGGGGGTATACGG - Intergenic
1047775515 8:128067309-128067331 ATGTGGGGCTAGAGAGTAGAAGG + Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048666095 8:136662973-136662995 GTTTGGGGGTAGAGGGTATATGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049469532 8:142769207-142769229 CTGCGGGGGTCGAGGGTTGGGGG + Intronic
1049784321 8:144443419-144443441 CTGTGGGGGTTAGGGGGAGCAGG - Intronic
1051221235 9:14850558-14850580 CTGTCGGGGTTGGGGGTGGAGGG + Intronic
1051288160 9:15517360-15517382 GTGTGGGGGTAGAGGGCATATGG - Intergenic
1052154980 9:25175380-25175402 CTGTGTGGATTGATGGTAGTAGG - Intergenic
1052480981 9:29025801-29025823 CAGGGGTGGTTAAGGGTAGAGGG - Intergenic
1052879295 9:33591000-33591022 GGGAGGGGGTTGCGGGTAGAAGG + Intergenic
1052998570 9:34564833-34564855 CTGTGGGGGGTGGGGGCACAGGG + Intronic
1053281287 9:36821055-36821077 CTGGTGGGGTTGGGGGCAGATGG + Intergenic
1053496683 9:38553218-38553240 GGGAGGGGGTTGCGGGTAGAAGG - Intronic
1053663786 9:40302967-40302989 CAGTGGGGGTTGTGGGTGGTAGG + Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053914332 9:42934225-42934247 CAGTGGGGGTTGTGGGTGGTAGG + Intergenic
1054520827 9:66073318-66073340 CAGTGGGGGTTGTGGGTGGTAGG - Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054730900 9:68702087-68702109 CTTTAGGGGTTGAGGTTGGAAGG + Intergenic
1054945800 9:70794754-70794776 CTGTGGGGGTTTACAGTAGCAGG - Intronic
1055717585 9:79134899-79134921 CTGTGGGGGGTGAGCATAGCAGG - Intergenic
1056037822 9:82627528-82627550 GTTTGGGGGTAGAGGGTATATGG + Intergenic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056844893 9:90029126-90029148 GTGTGGGGGCAGAGGGTAAATGG + Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059055886 9:110978910-110978932 CTGGGGTGGTTGTGGGGAGAGGG + Intronic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059354037 9:113686129-113686151 CTCTGGGCGCTGAGGGTGGAGGG + Intergenic
1059700284 9:116769334-116769356 CTGTGAGTGATGAGTGTAGAAGG + Intronic
1061081582 9:128374032-128374054 TTGGGGGGGTTGAAGGAAGATGG + Intronic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1186130464 X:6460116-6460138 GTGGGGGGGTAGAGGGTAGATGG + Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1186915362 X:14213337-14213359 CTTTAGGGGATGAGGGCAGAGGG + Intergenic
1187035025 X:15529317-15529339 AAGAGGGGGGTGAGGGTAGAAGG - Intronic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1187547104 X:20266045-20266067 CTGTGGGGGTTTCGGGTAGGGGG - Intronic
1187743751 X:22385541-22385563 GTGTGGATGTTGGGGGTAGATGG - Intergenic
1188413577 X:29904519-29904541 CTGTCGGGGTTGGGGGCAAAGGG - Intronic
1189269253 X:39739316-39739338 CTGTGGGCGTTGAGCGCAGTGGG + Intergenic
1189861966 X:45281962-45281984 CTGTTGGGGGTGAGGGGTGAGGG - Intergenic
1191083667 X:56540417-56540439 CTGTTGGGGGTGAGGGAAGGTGG + Intergenic
1191096598 X:56679684-56679706 CTGTGGGGGCTGAGGGGCTAGGG + Intergenic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1192444921 X:71203801-71203823 CTTTGGGAGGTCAGGGTAGAAGG + Intergenic
1193091683 X:77500550-77500572 CTGTAGGGGTTGGGGGGTGAGGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195588569 X:106597224-106597246 ATTAGGGGGTGGAGGGTAGATGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197229516 X:123988965-123988987 TGGTGGGGGCTGAGGGGAGAAGG - Intronic
1197593903 X:128443935-128443957 CTGTGGGGGTTGGGGGACTAGGG - Intergenic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1197680216 X:129374866-129374888 CTGTTGGGGGTGGGGGTTGAGGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199006059 X:142697474-142697496 CTGGGGGTGGTGGGGGTAGAAGG - Intergenic
1199031250 X:143003170-143003192 CTGTCGGGGTTGGGGGTATAGGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199718731 X:150526443-150526465 CTGTGGGGCTTGGAGGTACAGGG + Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1201686354 Y:16707559-16707581 CTGTTGGGGTTGAGGGGCTATGG + Intergenic