ID: 997981200

View in Genome Browser
Species Human (GRCh38)
Location 5:138468208-138468230
Sequence TTCCACTCCAGTAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997981200 Original CRISPR TTCCACTCCAGTAGAGAGGG AGG (reversed) Exonic
901631003 1:10648116-10648138 TTCCACTTCCGGACAGAGGGAGG - Exonic
905307557 1:37030050-37030072 TTAAACTCCAGTTGAGAAGGAGG + Intronic
905859460 1:41340243-41340265 TTCCACTCTGGTTGATAGGGAGG + Intergenic
906378518 1:45316570-45316592 TTCCTCTCCAGTAGAGACAAAGG + Intergenic
907857771 1:58320921-58320943 TGCTGCTCCAGGAGAGAGGGAGG - Intronic
908349348 1:63269112-63269134 AGCCACACCAGAAGAGAGGGTGG - Intergenic
908987365 1:70040046-70040068 TTCAACTCCATTAGAGGGGATGG + Intronic
912529709 1:110311550-110311572 TTCCTCTCCAGGAGGGATGGTGG - Intergenic
912864675 1:113246628-113246650 TTCCACTCCAGCAGAGGGGAGGG - Intergenic
915866029 1:159500399-159500421 TTTGACTCCAGTAGGGAGGCTGG - Intergenic
916949739 1:169767543-169767565 TTATACTTCAGTAGAGAGGAAGG + Intronic
919842427 1:201619084-201619106 CCCCACTGCAGTGGAGAGGGAGG + Intergenic
920948346 1:210550552-210550574 TTCCCCTGCAGGAGAGAAGGGGG - Intronic
922534792 1:226371903-226371925 TTCTTTTCCAGTAGTGAGGGCGG - Intronic
1063075308 10:2710833-2710855 GTTCACTCCAGTAGAGGGAGGGG - Intergenic
1067332533 10:45334788-45334810 TTCCAATCCAGCAGAGAGTGTGG - Intergenic
1070361845 10:75698178-75698200 TCCCACCCCATTAGTGAGGGAGG + Intronic
1071300389 10:84252104-84252126 TGACACTGCAGCAGAGAGGGGGG + Intronic
1071740636 10:88354544-88354566 TTACAAGCCAGAAGAGAGGGGGG - Intronic
1073558107 10:104473046-104473068 GTCCATTCCAGCAGAGATGGAGG - Intergenic
1073758832 10:106609060-106609082 TTCCACTCCAGGAAAGATGGTGG + Intronic
1074759204 10:116653540-116653562 TTACACTCCAGAAGAGATTGGGG - Intergenic
1075609645 10:123842127-123842149 CTCCACTCCTGTACAGGGGGAGG + Intronic
1078547485 11:12256638-12256660 TGCCACTGCAGCAAAGAGGGAGG - Intronic
1083522007 11:63322378-63322400 TTACAAGCCAGAAGAGAGGGAGG + Intronic
1084696312 11:70757650-70757672 GTCCCCTCAAGGAGAGAGGGAGG + Intronic
1085227170 11:74932448-74932470 ATATAGTCCAGTAGAGAGGGAGG - Intronic
1088023515 11:105149939-105149961 TTACATTCCAGTAGAGAAGAGGG + Intergenic
1088460106 11:110073919-110073941 TACCACTCCAGTACAGAAGAGGG - Intergenic
1089068015 11:115676711-115676733 ATCCAGTCCAGTGCAGAGGGAGG - Intergenic
1089688904 11:120173945-120173967 TTCCACTTCAGCTGGGAGGGAGG - Intronic
1090654612 11:128833356-128833378 TCCCACTCCAGTACATGGGGTGG - Intergenic
1090655770 11:128843884-128843906 TCCCATTTCAGCAGAGAGGGTGG + Intronic
1090756668 11:129797907-129797929 GTCCACTGCAGAAGAGAGGCTGG + Intergenic
1091595404 12:1875326-1875348 GCCCACTCCAGTACAGAGAGGGG - Exonic
1092354644 12:7784412-7784434 CTCAACTGCAGTAGTGAGGGGGG + Intergenic
1095785994 12:46109607-46109629 TTAGACTCCAGTAGGGATGGAGG + Intergenic
1097108609 12:56640840-56640862 TTCGACACCAGTAGAGACGGGGG + Intronic
1097283241 12:57858783-57858805 GTCCACTCCTGTTGAGAGGGAGG + Intergenic
1097481307 12:60129176-60129198 TTCCAATCCAGAAGGAAGGGAGG - Intergenic
1097518818 12:60643243-60643265 TTTCACTCCTGCAGAGAGAGAGG + Intergenic
1099933464 12:89099420-89099442 TTCCACTACCGTGGGGAGGGGGG + Intergenic
1103036641 12:117662290-117662312 TTACTCCCCAGAAGAGAGGGAGG - Intronic
1104864921 12:131947676-131947698 TCCCACTCCAGGAGAGAATGGGG + Intergenic
1106909222 13:34445463-34445485 TCTCACTCCAGAAGAGATGGTGG + Intergenic
1107449006 13:40491970-40491992 TTCCCCTGCAGAAGGGAGGGTGG - Intergenic
1107968186 13:45615856-45615878 TTCCCCGCCAGGAGAGAGGCTGG - Intergenic
1109815510 13:67577342-67577364 TTTGACTCAAGTAGAGACGGTGG - Intergenic
1113164898 13:107429148-107429170 TTATATTTCAGTAGAGAGGGGGG - Intronic
1118039379 14:61900754-61900776 TTCCATTCCAGGAAGGAGGGAGG + Intergenic
1119120663 14:72073473-72073495 TTCGACTCCAGAATAGTGGGTGG + Intronic
1119971667 14:78977667-78977689 TTCCATGACAGTAGAGAGGTGGG - Intronic
1120196498 14:81489670-81489692 TCCCACTCCAATAAAGAGGGAGG + Intronic
1121700621 14:95951309-95951331 TCCCACTCCAGCAGAGGGGTGGG - Intergenic
1122205703 14:100146900-100146922 TTCCGCACCTGTAGAGAGGAGGG + Exonic
1122323235 14:100867865-100867887 TTCCACTCCAGGACACAGGAGGG - Intergenic
1122507430 14:102240544-102240566 TTCCTCTCTAGTAGAGACGAAGG + Intronic
1124015617 15:25872192-25872214 GTCCACTCCAGAAAAGAAGGTGG + Intergenic
1124868666 15:33519100-33519122 ATCCACACCAGTGGGGAGGGAGG + Intronic
1125479360 15:40069697-40069719 CACCACTCCAGGACAGAGGGAGG + Intergenic
1128239655 15:66093324-66093346 TTCCACTGCAGCAGAGAGAGGGG + Intronic
1128995428 15:72291157-72291179 TGCCACTCCCATAGAAAGGGTGG - Intronic
1129083479 15:73063292-73063314 TTTCAGCCCAGTAGAGTGGGTGG - Intronic
1129193958 15:73953349-73953371 TTCTGGTGCAGTAGAGAGGGAGG + Intergenic
1130133951 15:81166028-81166050 GGCCATTCCAGTAGAGAGAGGGG + Intronic
1133200113 16:4198939-4198961 TTCAAATCCAGTGGACAGGGAGG + Intronic
1137691961 16:50434649-50434671 CTCCACGACAGTAGAGAAGGAGG - Intergenic
1138531701 16:57637953-57637975 TTCCAGGCCAGCAGATAGGGTGG - Intronic
1140758783 16:78092460-78092482 CTCCTCTCCAGAAGAAAGGGAGG - Intergenic
1142203993 16:88774020-88774042 TTCCAAGCCAGGGGAGAGGGAGG - Intronic
1202995092 16_KI270728v1_random:101160-101182 TTACAATCCAGAAGAGAGTGGGG + Intergenic
1203021779 16_KI270728v1_random:413502-413524 TTACAATCCAGAAGAGAGTGGGG + Intergenic
1148445418 17:47734254-47734276 CTCCTCTACAGTAGAGAGTGGGG - Intronic
1151082288 17:71342855-71342877 TTGAACTCTAGTAGGGAGGGTGG - Intergenic
1157573982 18:48731454-48731476 TTCCACTCAGGCATAGAGGGTGG - Intronic
1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG + Intergenic
1160034120 18:75285680-75285702 TTCCTCTCGAGAAGAGAAGGAGG + Exonic
1162261795 19:9539986-9540008 TTCCTCTCCAGTAGAGACAAAGG + Intergenic
1164090387 19:21946458-21946480 TCCTACTCCAGCAGAGAGGGAGG - Intronic
1164194513 19:22944267-22944289 CCCTACTCCAGCAGAGAGGGAGG - Intergenic
1166164224 19:40975831-40975853 ATCCACTCCAGTACAGAAGATGG - Intergenic
1166186609 19:41143538-41143560 ATCCACTCCAGTACAGAAGATGG + Intergenic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1168671441 19:58244046-58244068 TTCCACCCCAGGTGAGTGGGGGG + Exonic
925653033 2:6112653-6112675 TTACCCACCAGTGGAGAGGGAGG + Intergenic
926009388 2:9396240-9396262 TCCCACTCCAGCAGTGAGGAAGG - Intronic
928769390 2:34688222-34688244 TTACTTTCCAGTAGAGAGGCAGG - Intergenic
929008240 2:37416097-37416119 TACCTCTCCAGAAGAGAGTGAGG + Intergenic
929484538 2:42342084-42342106 TGCCTCGCCACTAGAGAGGGTGG - Intronic
929562313 2:42963536-42963558 TTCCACTCCAGGAGTCAGGATGG + Intergenic
932626399 2:73299701-73299723 TTCTCCTACAGGAGAGAGGGAGG + Intergenic
932649549 2:73540183-73540205 CTCCAATCCAGAAGAGAGTGGGG + Intronic
932660355 2:73646532-73646554 CTCCAATCCAGAAGAGAGTGGGG - Intergenic
934699463 2:96428191-96428213 TGCCAGTCCAGGAGAGGGGGTGG - Intergenic
937199448 2:120189408-120189430 TTCCACTCCACTGGAGGGGGAGG + Intergenic
940757985 2:157705073-157705095 TTCCAAGCCAGCAGAGAGGGAGG - Intergenic
942654789 2:178204194-178204216 TTGCATTTTAGTAGAGAGGGTGG + Intronic
942821257 2:180118660-180118682 TTCCTCTGCAGTAGAGAGAAAGG - Intergenic
1168818161 20:755032-755054 TGCCAGCCCAGGAGAGAGGGAGG + Intergenic
1169580209 20:7013815-7013837 TTTCAATCCAGTAGAGATGGTGG + Intergenic
1169740207 20:8885086-8885108 TTCCACTCCTGGATGGAGGGTGG - Intronic
1170762227 20:19261191-19261213 CTAAACTGCAGTAGAGAGGGAGG - Intronic
1171136562 20:22700252-22700274 GTTCTCTCCAGTAAAGAGGGAGG - Intergenic
1171202721 20:23255032-23255054 ATCAACTCCAGCAGGGAGGGGGG - Intergenic
1172114750 20:32567068-32567090 TTCCATGCCAGTAAAGAGAGGGG - Intronic
1173651765 20:44670913-44670935 TTCCTCTCCAGTAGAGACAAAGG + Intergenic
1176201033 20:63860666-63860688 TACCTCTCCAGAAAAGAGGGAGG + Intergenic
1178730103 21:35094031-35094053 TGCCACTCAAGTGGAGAGAGAGG - Intronic
1183414941 22:37676573-37676595 TTCCTCTCCAGCAGAGGGGCCGG + Intronic
1184357280 22:43990823-43990845 TTCCTCTGCTGTAGAGAGAGGGG - Intronic
950153291 3:10704717-10704739 TTCCACTTAATTGGAGAGGGTGG + Intronic
950743250 3:15066181-15066203 TTGCACTCCAGAAGGGAGGGAGG - Intergenic
952014762 3:28943193-28943215 TTCCACAGCAGTAGGTAGGGAGG - Intergenic
952296608 3:32068148-32068170 TTCCTCTCTAGTAGAGACAGAGG + Intronic
961833772 3:129639791-129639813 TTGCATTTTAGTAGAGAGGGGGG - Intergenic
963400477 3:144791150-144791172 TTCCCCTCCTGGAGCGAGGGAGG - Intergenic
963851824 3:150217213-150217235 TTTCACTGCTGAAGAGAGGGTGG + Intergenic
964428242 3:156575870-156575892 TGCCACTGCAGTGGGGAGGGAGG + Intergenic
966881211 3:184352325-184352347 CGTCACTCTAGTAGAGAGGGAGG + Exonic
967296173 3:187967318-187967340 TTGCACTCCAGTAAGGAGGCAGG + Intergenic
967435017 3:189433476-189433498 TTACAATCCAGTAGAGATTGGGG + Intergenic
967833632 3:193943060-193943082 TTTCACTCCAGTAGATACAGAGG + Intergenic
967966103 3:194961285-194961307 TTCCACCCCAGCAGACAGCGTGG - Intergenic
968731796 4:2272678-2272700 TTCCACCCCCATAGAGAGGCGGG + Intronic
969366370 4:6696877-6696899 TTCCACTCTAGAGGAGAGAGAGG - Exonic
971648558 4:29240131-29240153 TTCCCCTCCAGTGGAGTGAGAGG - Intergenic
973001866 4:44961588-44961610 TTCCAATCCAGGAAAGAAGGTGG + Intergenic
973744202 4:53947227-53947249 TTCCAGTGAAGGAGAGAGGGTGG - Intronic
979424548 4:120549471-120549493 TTGAAGTCCAGTAGACAGGGAGG - Intergenic
980560230 4:134462655-134462677 TTCCATTCCAGTGGGGAAGGAGG + Intergenic
983459470 4:168010076-168010098 TTCCACTATATAAGAGAGGGTGG - Intergenic
983891932 4:173038429-173038451 CTCCACCCCAGAGGAGAGGGAGG + Intronic
985657712 5:1140646-1140668 TCCCACTGGAGTAGAGAGCGTGG - Intergenic
987456623 5:18155172-18155194 TTCCACTCAACTGGAGAGGAGGG - Intergenic
990242123 5:53826375-53826397 TTCCCCAGCAGTAGGGAGGGTGG + Intergenic
994366822 5:98927463-98927485 TTCCATTCCACAAGAGAGGGAGG + Intronic
996022745 5:118609523-118609545 TCCCACTGCAGTAGAGAGTTAGG - Intergenic
997981200 5:138468208-138468230 TTCCACTCCAGTAGAGAGGGAGG - Exonic
998793585 5:145793072-145793094 TTCCACTCCAGGAGGAAGGAGGG + Intronic
999032219 5:148306560-148306582 GTTCACTCCAGTGGAGAGAGGGG - Intergenic
1001303839 5:170557029-170557051 TTCCACTCCACTGCTGAGGGAGG - Intronic
1002639051 5:180621995-180622017 GGCCCCTCCAGGAGAGAGGGAGG - Intronic
1004032571 6:11885173-11885195 TTCCACCCCAGTTAAGGGGGTGG + Intergenic
1006163149 6:32049583-32049605 TTCCTCTGCAGTGGAGAAGGAGG + Intronic
1006521382 6:34573120-34573142 TGCCTCTCCAGAAGAGAAGGAGG + Intergenic
1015382909 6:132589722-132589744 TTGCCCTCCAGTGGAGAAGGTGG - Intergenic
1015976626 6:138797449-138797471 CTCCACTACAGTAGACAGAGTGG - Intronic
1017377440 6:153787387-153787409 CTCCACTCCAGTACACAGGCAGG - Intergenic
1022471321 7:30683328-30683350 TTCCACACCAGTAGCGGGGCAGG + Intronic
1024056905 7:45665772-45665794 TCCCACTGCAGGAGGGAGGGAGG + Intronic
1024784513 7:52892175-52892197 TTTCACTACAGTAGAAAGGTTGG + Intergenic
1037865590 8:22440460-22440482 TTCCAGTCCAGTAGCTAGGGCGG - Intergenic
1041082321 8:54225568-54225590 TTCCAGTCCAGTGGGGAGAGAGG - Intergenic
1041985664 8:63920012-63920034 TTCCAATTTAGTAGAGAGGAAGG + Intergenic
1043920161 8:85973517-85973539 TTCCTCTCAAGTAGAGATTGGGG + Intergenic
1046276326 8:111965006-111965028 CTCCAAGCCAGTAGAGAGTGGGG - Intergenic
1047213623 8:122859439-122859461 TTCCCCTCCAGGATTGAGGGAGG - Intronic
1048173954 8:132134688-132134710 TTCTATCCCAGGAGAGAGGGAGG + Intronic
1048292341 8:133190753-133190775 TTTCACTACTGTAGGGAGGGGGG - Intergenic
1050951159 9:11596205-11596227 CTCCACTCATGTAGAGATGGAGG + Intergenic
1053140527 9:35679951-35679973 GTCCACTCCAGCAGGGAAGGAGG - Exonic
1056265808 9:84895760-84895782 TTCCACTGCAGAAGTGAGGTGGG - Intronic
1056363506 9:85881611-85881633 TTCCTCTCTAGTAGAGAGAAAGG + Intergenic
1057871876 9:98724236-98724258 TCCTACACCTGTAGAGAGGGAGG + Intergenic
1059556298 9:115283988-115284010 TTGCACTTTAGTAGAGACGGGGG - Intronic
1185561092 X:1061135-1061157 TTCCAGACCCCTAGAGAGGGAGG - Intergenic
1194247761 X:91537025-91537047 TTCAACTCCAGAAAAGTGGGTGG + Intergenic
1194986888 X:100500401-100500423 TTCCACTCCAGAGGAGAATGAGG + Intergenic
1195510077 X:105705506-105705528 TTCCAGTCAAGTAGAGAGATGGG + Intronic
1199908402 X:152259479-152259501 TTCCACTCGAGTAGAGGAGAGGG + Intronic
1199947741 X:152681571-152681593 TTCCACCCCAGAACAGAAGGGGG + Intergenic
1199955177 X:152736280-152736302 TTCCACTAGAGTAGAGGAGGAGG - Exonic
1199961938 X:152786883-152786905 TTCCACCCCAGAACAGAAGGGGG - Intergenic
1200412551 Y:2875921-2875943 TTCCACTCCAGCAGAGGGTTGGG + Intronic
1202170542 Y:22039060-22039082 TTCCACTCCAGCAGAGGGTTGGG + Intergenic
1202220822 Y:22547313-22547335 TTCCACTCCAGCAGAGGGTTGGG - Intergenic
1202322291 Y:23648350-23648372 TTCCACTCCAGCAGAGGGTTGGG + Intergenic
1202548479 Y:26021706-26021728 TTCCACTCCAGCAGAGGGTTGGG - Intergenic