ID: 997981461

View in Genome Browser
Species Human (GRCh38)
Location 5:138470143-138470165
Sequence CAATGGGAACAGATTTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997981461_997981468 0 Left 997981461 5:138470143-138470165 CCGGGCCAAATCTGTTCCCATTG No data
Right 997981468 5:138470166-138470188 TGTAGGAGGCCTGAGGTTCTAGG No data
997981461_997981471 10 Left 997981461 5:138470143-138470165 CCGGGCCAAATCTGTTCCCATTG No data
Right 997981471 5:138470176-138470198 CTGAGGTTCTAGGTTCTTTTGGG No data
997981461_997981472 25 Left 997981461 5:138470143-138470165 CCGGGCCAAATCTGTTCCCATTG No data
Right 997981472 5:138470191-138470213 CTTTTGGGCCCAGTCCCCTGAGG No data
997981461_997981466 -7 Left 997981461 5:138470143-138470165 CCGGGCCAAATCTGTTCCCATTG No data
Right 997981466 5:138470159-138470181 CCCATTGTGTAGGAGGCCTGAGG No data
997981461_997981473 26 Left 997981461 5:138470143-138470165 CCGGGCCAAATCTGTTCCCATTG No data
Right 997981473 5:138470192-138470214 TTTTGGGCCCAGTCCCCTGAGGG No data
997981461_997981470 9 Left 997981461 5:138470143-138470165 CCGGGCCAAATCTGTTCCCATTG No data
Right 997981470 5:138470175-138470197 CCTGAGGTTCTAGGTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997981461 Original CRISPR CAATGGGAACAGATTTGGCC CGG (reversed) Intergenic
No off target data available for this crispr