ID: 997981849

View in Genome Browser
Species Human (GRCh38)
Location 5:138472591-138472613
Sequence CTGAATAGGGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997981849_997981858 2 Left 997981849 5:138472591-138472613 CCTTCCACCTTCCCCCTATTCAG No data
Right 997981858 5:138472616-138472638 CCGCCCCTATCCCCCAGGTATGG No data
997981849_997981868 15 Left 997981849 5:138472591-138472613 CCTTCCACCTTCCCCCTATTCAG No data
Right 997981868 5:138472629-138472651 CCAGGTATGGAACTGGAGGCAGG No data
997981849_997981869 30 Left 997981849 5:138472591-138472613 CCTTCCACCTTCCCCCTATTCAG No data
Right 997981869 5:138472644-138472666 GAGGCAGGTAAGAGTACTATAGG No data
997981849_997981862 8 Left 997981849 5:138472591-138472613 CCTTCCACCTTCCCCCTATTCAG No data
Right 997981862 5:138472622-138472644 CTATCCCCCAGGTATGGAACTGG No data
997981849_997981863 11 Left 997981849 5:138472591-138472613 CCTTCCACCTTCCCCCTATTCAG No data
Right 997981863 5:138472625-138472647 TCCCCCAGGTATGGAACTGGAGG No data
997981849_997981856 -3 Left 997981849 5:138472591-138472613 CCTTCCACCTTCCCCCTATTCAG No data
Right 997981856 5:138472611-138472633 CAGAACCGCCCCTATCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997981849 Original CRISPR CTGAATAGGGGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr