ID: 997982216

View in Genome Browser
Species Human (GRCh38)
Location 5:138475428-138475450
Sequence AGCCCAGATGTCCCTCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997982216_997982220 -1 Left 997982216 5:138475428-138475450 CCCTGTGGAGGGACATCTGGGCT No data
Right 997982220 5:138475450-138475472 TGGTTCCTTTGGCGCTATTATGG No data
997982216_997982222 21 Left 997982216 5:138475428-138475450 CCCTGTGGAGGGACATCTGGGCT No data
Right 997982222 5:138475472-138475494 GATAAAGCTGCTGTGATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997982216 Original CRISPR AGCCCAGATGTCCCTCCACA GGG (reversed) Intergenic
No off target data available for this crispr