ID: 997982222

View in Genome Browser
Species Human (GRCh38)
Location 5:138475472-138475494
Sequence GATAAAGCTGCTGTGATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997982221_997982222 -6 Left 997982221 5:138475455-138475477 CCTTTGGCGCTATTATGGATAAA No data
Right 997982222 5:138475472-138475494 GATAAAGCTGCTGTGATTATTGG No data
997982215_997982222 22 Left 997982215 5:138475427-138475449 CCCCTGTGGAGGGACATCTGGGC No data
Right 997982222 5:138475472-138475494 GATAAAGCTGCTGTGATTATTGG No data
997982217_997982222 20 Left 997982217 5:138475429-138475451 CCTGTGGAGGGACATCTGGGCTG No data
Right 997982222 5:138475472-138475494 GATAAAGCTGCTGTGATTATTGG No data
997982212_997982222 27 Left 997982212 5:138475422-138475444 CCTTTCCCCTGTGGAGGGACATC No data
Right 997982222 5:138475472-138475494 GATAAAGCTGCTGTGATTATTGG No data
997982216_997982222 21 Left 997982216 5:138475428-138475450 CCCTGTGGAGGGACATCTGGGCT No data
Right 997982222 5:138475472-138475494 GATAAAGCTGCTGTGATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997982222 Original CRISPR GATAAAGCTGCTGTGATTAT TGG Intergenic
No off target data available for this crispr