ID: 997982233

View in Genome Browser
Species Human (GRCh38)
Location 5:138475559-138475581
Sequence ATGTGGATATGGTGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997982233_997982237 -7 Left 997982233 5:138475559-138475581 CCTTCTTCCCACCATATCCACAT No data
Right 997982237 5:138475575-138475597 TCCACATTTTTTCACATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997982233 Original CRISPR ATGTGGATATGGTGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr