ID: 997982630

View in Genome Browser
Species Human (GRCh38)
Location 5:138478437-138478459
Sequence GTTCTAATGAGATTCAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997982630_997982633 1 Left 997982630 5:138478437-138478459 CCACCTTTGAATCTCATTAGAAC No data
Right 997982633 5:138478461-138478483 AACTTTGAATTCCCTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997982630 Original CRISPR GTTCTAATGAGATTCAAAGG TGG (reversed) Intergenic
No off target data available for this crispr