ID: 997983446

View in Genome Browser
Species Human (GRCh38)
Location 5:138485329-138485351
Sequence TTCTGTAACCATTGCATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997983446_997983450 25 Left 997983446 5:138485329-138485351 CCTTTCATGCAATGGTTACAGAA No data
Right 997983450 5:138485377-138485399 CTAAATCTATTATCTCATTAGGG No data
997983446_997983449 24 Left 997983446 5:138485329-138485351 CCTTTCATGCAATGGTTACAGAA No data
Right 997983449 5:138485376-138485398 TCTAAATCTATTATCTCATTAGG No data
997983446_997983451 26 Left 997983446 5:138485329-138485351 CCTTTCATGCAATGGTTACAGAA No data
Right 997983451 5:138485378-138485400 TAAATCTATTATCTCATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997983446 Original CRISPR TTCTGTAACCATTGCATGAA AGG (reversed) Intergenic
No off target data available for this crispr