ID: 997986906

View in Genome Browser
Species Human (GRCh38)
Location 5:138508917-138508939
Sequence CACACAGACATGCCTATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997986906_997986908 18 Left 997986906 5:138508917-138508939 CCATTTATAGGCATGTCTGTGTG 0: 1
1: 0
2: 1
3: 35
4: 296
Right 997986908 5:138508958-138508980 CTCTGGTTTTGATAACCTAATGG 0: 1
1: 0
2: 1
3: 8
4: 151
997986906_997986907 1 Left 997986906 5:138508917-138508939 CCATTTATAGGCATGTCTGTGTG 0: 1
1: 0
2: 1
3: 35
4: 296
Right 997986907 5:138508941-138508963 AAAGCTCTGTAAGTCATCTCTGG 0: 1
1: 0
2: 0
3: 21
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997986906 Original CRISPR CACACAGACATGCCTATAAA TGG (reversed) Intronic
902262082 1:15233736-15233758 CACACAGACATAAATATATAGGG - Intergenic
904115156 1:28156318-28156340 CACAGATACATACTTATAAAGGG - Intronic
904187241 1:28715070-28715092 CACACAGACGAGCCTGGAAATGG - Intronic
905852716 1:41286183-41286205 CACACTGACATGCTTATACATGG - Intergenic
906998152 1:50820469-50820491 CACACACACATGCACACAAAAGG - Intronic
909304422 1:74055211-74055233 TACACACACATACATATAAAGGG + Intronic
909435604 1:75637836-75637858 TACACAGACATGCCTTTAAAAGG + Intergenic
909763892 1:79330406-79330428 CACACACATATGTCAATAAAAGG - Intergenic
910091669 1:83471777-83471799 CACACACACATGACTAGAAGAGG + Intergenic
910527108 1:88192362-88192384 CACACACACACACATATAAAGGG + Intergenic
911502453 1:98705072-98705094 CACACAGATATACCCACAAAAGG + Intronic
911862668 1:102972960-102972982 CACACAGACATATATATATATGG - Intronic
911883910 1:103273129-103273151 CACACACACATATATATAAAGGG - Intergenic
912545388 1:110447421-110447443 CACACACACATCTGTATAAATGG + Intergenic
913175680 1:116270936-116270958 CACATAGAGATGCCTAATAATGG - Intergenic
914702094 1:150143943-150143965 TACACACACATGGCTTTAAACGG + Intronic
915023453 1:152804390-152804412 CACACATGCATGTATATAAATGG - Intronic
919048030 1:192478307-192478329 CACACACACATGCACATATATGG + Intergenic
920256325 1:204657357-204657379 CACACACACACGCATATATATGG + Intronic
920592354 1:207232436-207232458 CACAGAGACTTGGCTATAACGGG + Intergenic
921650125 1:217668020-217668042 CAAACAGAAATTCATATAAAAGG - Intronic
922455885 1:225773170-225773192 CACAATGACTGGCCTATAAAAGG + Intergenic
922744442 1:228036343-228036365 CACACAGGCATGCACATATATGG - Intronic
923264156 1:232297187-232297209 CACACAGACATGATTTTAAAAGG - Intergenic
923733606 1:236579304-236579326 CACACAAGCATGCCCACAAAGGG + Intronic
923984551 1:239366318-239366340 CACACATATGTACCTATAAAGGG - Intergenic
1063283443 10:4657160-4657182 CACACATACATATGTATAAAAGG - Intergenic
1063750346 10:8937266-8937288 AAAACAGACATGCTTATCAATGG - Intergenic
1065269019 10:24007642-24007664 CACAAAGACAGGCATATAAATGG - Intronic
1066512066 10:36111714-36111736 CACACAGACAGGCAGAGAAAGGG - Intergenic
1068770066 10:60810831-60810853 CACAAATACAGGCCAATAAATGG + Intergenic
1069097652 10:64279041-64279063 CACACAGACAGGCCCATAAGGGG - Intergenic
1072838582 10:98744166-98744188 AACACAGACAGGCTTCTAAAAGG + Intronic
1074570532 10:114620254-114620276 CATATACACATGCATATAAATGG - Intronic
1076228238 10:128798388-128798410 CACACAAACATGCATACATATGG + Intergenic
1078171440 11:8931990-8932012 CACACAGATATGCCAATCATAGG + Intronic
1078300456 11:10125516-10125538 CAGACAGACACACATATAAAAGG - Intronic
1079375777 11:19890573-19890595 CCCACAGATAGGCCTAGAAAAGG - Intronic
1080254680 11:30276716-30276738 CACACATACATGCCAAAACAGGG + Intergenic
1081010815 11:37810862-37810884 CACACAGAGATGCACATAGAGGG + Intergenic
1082962074 11:58927923-58927945 CACACGGAAAAGCCTAAAAAGGG - Intronic
1084218102 11:67662472-67662494 CACACACACATGCCCGTAACAGG - Exonic
1085923161 11:80982692-80982714 CACACAGACATACCTGATAAAGG + Intergenic
1085966336 11:81532164-81532186 CACACACACATGCATTCAAAAGG + Intergenic
1086571210 11:88286490-88286512 CCTACTGACATGACTATAAAAGG - Intergenic
1087583278 11:100086544-100086566 CACACACACATACATATATATGG - Intronic
1087915981 11:103811296-103811318 CACACATGAATGCCTAAAAAAGG + Intergenic
1089187160 11:116626414-116626436 CACATATACATACATATAAAAGG + Intergenic
1089671436 11:120059835-120059857 CACACACACATCCCTGTAACAGG - Intergenic
1089911727 11:122107523-122107545 AACACAAACATGACTATAAGTGG - Intergenic
1091081683 11:132675143-132675165 CACACACACATACATATATATGG - Intronic
1091356141 11:134939118-134939140 CACACAGAAATGCAGAGAAAGGG + Intergenic
1091800127 12:3319890-3319912 CACACAGACCTACCCATAGATGG + Intergenic
1093128230 12:15356455-15356477 CACATAGTAATGCCTATAAATGG + Intronic
1093324531 12:17758239-17758261 CACACAGACATATATATATATGG - Intergenic
1094131990 12:27084414-27084436 CACAGAGACATGCTTACAAATGG + Intergenic
1094181420 12:27596101-27596123 CACACACATATGCTTACAAATGG + Intronic
1094241962 12:28238597-28238619 CATACAGAAATGCTTATATATGG - Intronic
1094365642 12:29677243-29677265 TAAACAGACATGCAGATAAAGGG - Intronic
1102458316 12:113084683-113084705 AAGAGAGACATGCCTGTAAATGG - Intronic
1102561192 12:113763332-113763354 CACACAGACATGCACACACACGG - Intergenic
1102841410 12:116128330-116128352 CAAACAGACACGTTTATAAAAGG + Intronic
1105676570 13:22678531-22678553 CATACATACATACATATAAAGGG - Intergenic
1106339757 13:28817582-28817604 CACACATAAATCCATATAAATGG + Intergenic
1106940007 13:34767939-34767961 CACACAGGCATTTCTATAACTGG - Intergenic
1108060396 13:46527247-46527269 CTCAGAGACATGCCTTTTAAAGG + Intergenic
1111095597 13:83511011-83511033 CACACACACATGCTTAAAAGTGG - Intergenic
1111285236 13:86082114-86082136 TACACAGAGATGCCAGTAAAAGG + Intergenic
1111603008 13:90497885-90497907 CACACATATATGACTAGAAATGG - Intergenic
1113238001 13:108302995-108303017 AACCCAGACATTCATATAAAGGG + Intronic
1113386211 13:109850748-109850770 CACACACACATGCACACAAAGGG - Intergenic
1114520546 14:23331931-23331953 CACACACACATACATACAAATGG - Intergenic
1116869671 14:50059468-50059490 CACACATACATGAATATATAGGG + Intergenic
1116886247 14:50224356-50224378 CACACACACATATATATAAATGG + Intronic
1116981419 14:51174943-51174965 CACACACACATGCTTTTAAAAGG - Intergenic
1122002344 14:98669673-98669695 CAGACAGAAATGCCCATCAAGGG - Intergenic
1123693727 15:22861687-22861709 CCCACTGACATGCCTAGAGATGG + Intronic
1123711675 15:22992512-22992534 CACACACACATGTATATTAATGG + Intronic
1124814760 15:32978743-32978765 CTCACACACTTGTCTATAAACGG + Intronic
1126290690 15:47073468-47073490 GACACGGACATGCCTTTAGAAGG + Intergenic
1126689370 15:51276109-51276131 CACACATGCCTGCATATAAATGG - Intronic
1127327725 15:57911815-57911837 CAAACAGAAGTGCTTATAAAAGG + Intergenic
1129630079 15:77249163-77249185 CACATAGGCTTCCCTATAAAAGG + Intronic
1129883782 15:79025007-79025029 CACACACACATGCCTTTTAGGGG + Intronic
1134796253 16:17039747-17039769 CACACACACAAGTCTATTAATGG - Intergenic
1136338204 16:29624693-29624715 CCAACAGACATACCTATAGACGG + Intergenic
1138376097 16:56565030-56565052 TACACCCACATGGCTATAAATGG + Exonic
1139091666 16:63655654-63655676 TACACAGACTTGCCTACATAGGG - Intergenic
1140273260 16:73485009-73485031 CTCAGAGACACGACTATAAAAGG + Intergenic
1140696191 16:77536513-77536535 CACACAGACATGTCTAAACCAGG + Intergenic
1143808493 17:9450472-9450494 CACACACACATCCGTATATATGG - Intronic
1144117847 17:12117480-12117502 CACATAAGCATGCCTACAAAGGG + Intronic
1144453336 17:15399188-15399210 CACACAGAGATGGCTTTTAACGG + Intergenic
1144547267 17:16209083-16209105 GATACAGACATGCCTACAAAGGG + Intronic
1145026585 17:19472259-19472281 CACACACACACACCCATAAATGG + Intergenic
1145299107 17:21618263-21618285 GATACAGACATGCCTACAAAGGG - Intergenic
1145351175 17:22085020-22085042 GATACAGACATGCCTACAAAGGG + Intergenic
1145366312 17:22269399-22269421 CACACAGACAGGCCACAAAAAGG - Intergenic
1147520828 17:41171350-41171372 TACACAGAGAGGCCTACAAAAGG + Intergenic
1151036592 17:70807869-70807891 CACAGAAACATGCCTGCAAAAGG - Intergenic
1151123603 17:71820512-71820534 CATACATACATGCATATATAAGG + Intergenic
1151397528 17:73833783-73833805 CACACAGTGGTGCCTATTAAAGG + Intergenic
1152323188 17:79620332-79620354 CACACAGACATGCACACACACGG + Intergenic
1153047386 18:869264-869286 CACTCAGACATTCCCTTAAAGGG - Intergenic
1153442807 18:5139535-5139557 CACACAGATATACCTAGAAAAGG + Intergenic
1154235553 18:12602129-12602151 CACACACACATACACATAAAGGG + Intronic
1154498480 18:14980175-14980197 CACACAGAAATGCAGAGAAAGGG - Intergenic
1155606097 18:27607723-27607745 AATACAGACATGCCTAGAATTGG + Intergenic
1155706883 18:28826583-28826605 CACAAACACATGTTTATAAAAGG - Intergenic
1155987231 18:32243146-32243168 GACACAGACATGCATACAAGGGG + Intronic
1159674594 18:71265877-71265899 CACACACACACGAATATAAAGGG + Intergenic
1164055970 19:21622507-21622529 TACACAGAAGTGCCTAAAAAGGG + Intergenic
1164127881 19:22335049-22335071 CACACAGACATACAGATAAAGGG + Intergenic
1166395458 19:42436654-42436676 CACAGCAACATGCCTATGAATGG - Intronic
1166455342 19:42935917-42935939 CACACACACACACATATAAAAGG + Intronic
1168341980 19:55629813-55629835 CACACACACACACCTCTAAATGG + Intergenic
925469271 2:4141315-4141337 CACACAGCCGTGCATATAACAGG + Intergenic
928194704 2:29206767-29206789 CACACACACACACCAATAAAGGG - Intronic
928235509 2:29535994-29536016 CACACATACATCCCTAGGAAGGG + Intronic
928571184 2:32610495-32610517 CACACAGAAATCCCCAGAAATGG - Intronic
930162424 2:48171675-48171697 CACACACACAAGTCTAGAAAGGG - Intergenic
930275788 2:49309785-49309807 TGGACAGACATGGCTATAAAGGG + Intergenic
931509097 2:62969831-62969853 TAAGCAGACATGCTTATAAATGG - Intronic
931606246 2:64055532-64055554 CACACAAACATGTCTATCACAGG - Intergenic
933526895 2:83453021-83453043 CACACATACATACATATATATGG + Intergenic
935515452 2:104031085-104031107 CACACATACATGCAAATAAAGGG - Intergenic
935700286 2:105806173-105806195 CACACACACATACATATACAAGG - Intronic
936579186 2:113681805-113681827 CACACAAACATACATATAATAGG + Intergenic
937131437 2:119517052-119517074 CACACACACATGCACACAAATGG + Intronic
939156830 2:138535759-138535781 CACACTGACATGTATATAATGGG - Intronic
940520125 2:154735057-154735079 CACACACACAGGCCTACAAGGGG - Intronic
942133782 2:172905767-172905789 CACGTAGAAATGTCTATAAAAGG + Intronic
943072922 2:183163213-183163235 CAGAAAGGCATGCCCATAAATGG + Intergenic
943698610 2:190964331-190964353 CACACACACATGCACACAAATGG + Exonic
943861321 2:192867102-192867124 TACACAAACATGCATATATATGG + Intergenic
945692718 2:213060483-213060505 CACAAAGACATCCTCATAAATGG + Intronic
945739503 2:213643029-213643051 CACACACACATACATATAAAGGG - Intronic
947331678 2:229035469-229035491 CTCACACACATACATATAAATGG + Intronic
947556309 2:231096389-231096411 TACACAGAAGTGCCTAAAAAGGG - Intronic
1169828803 20:9799488-9799510 CACACACACATTCTTATTAATGG - Intronic
1170028261 20:11914843-11914865 CACACATACAGGCATACAAATGG - Intronic
1171561425 20:26129996-26130018 GATACAGACATGCCTACAAAGGG + Intergenic
1172056714 20:32159323-32159345 CACACTTACATGCCTCTGAAGGG - Intronic
1175401933 20:58705780-58705802 CACACAGCAATGCCTGGAAACGG - Intronic
1176649824 21:9535298-9535320 GATACAGACATGCCTACAAAGGG - Intergenic
1177502394 21:21974870-21974892 CATACATACATGCACATAAAGGG + Intergenic
1178921196 21:36739581-36739603 AACACAGACTTACCTACAAAGGG - Intronic
1179359453 21:40692016-40692038 CATACAGACATGTCTAAAAAAGG + Intronic
1181138798 22:20788390-20788412 CCCACAGGCATGCCTACAAAGGG - Intronic
1182029560 22:27147218-27147240 CTCAATGCCATGCCTATAAAGGG - Intergenic
1185311876 22:50160658-50160680 CACACAGAGATGAATAAAAATGG - Intronic
949610011 3:5694332-5694354 TACACAGACATGCCTCCAATTGG - Intergenic
950705089 3:14774598-14774620 CACACAGACCTGTCTCTGAAGGG + Intergenic
950846264 3:16018844-16018866 TACACAGAAATGCCTCTAATAGG - Intergenic
950902283 3:16508713-16508735 CACACACACACCCCTTTAAAAGG + Intronic
952084465 3:29801014-29801036 CACACACACACACCTGTAAACGG + Intronic
953234275 3:41092621-41092643 CACACACACACGCATATAATGGG - Intergenic
954306247 3:49727024-49727046 CACACAGACTTGCTTTTAAAGGG - Exonic
957294055 3:78313094-78313116 CACACACACATGCAAATAGATGG - Intergenic
957357656 3:79113153-79113175 AAAACAGACATGCTGATAAATGG - Intronic
957645491 3:82918952-82918974 CACACATACACGCATATATACGG + Intergenic
959159596 3:102707281-102707303 CACACAAGCATGCCCACAAAGGG - Intergenic
959377124 3:105601125-105601147 CACACACACACACTTATAAAGGG + Intergenic
959521328 3:107326041-107326063 CACACAGACATTCCTCAAATAGG + Intergenic
961449729 3:126997213-126997235 CACACAGCCATGCTTACAACAGG - Intronic
962627647 3:137242414-137242436 CAAATATACATGCCTGTAAAAGG - Intergenic
963369398 3:144379200-144379222 CACACAAGCATGCCCACAAAGGG - Intergenic
963867233 3:150375733-150375755 CATACTGACATGCAAATAAAGGG - Intergenic
964481970 3:157148421-157148443 CAAACAGACATGGTCATAAAAGG - Exonic
964945286 3:162215626-162215648 CACACAAACATGCACATATAAGG - Intergenic
966426612 3:179786834-179786856 CACACAGACACCCATATACAGGG - Exonic
969469146 4:7376685-7376707 CACAAAGACATGCATATGTATGG - Intronic
972871238 4:43301450-43301472 CACACACACACACATATAAATGG - Intergenic
974664408 4:64939227-64939249 CACACACACATATATATAAAGGG + Intergenic
975685269 4:76914802-76914824 CACACACACATATATATAAAGGG + Intergenic
976008778 4:80461913-80461935 AACACAGACATGTTTATAGATGG - Intronic
976321897 4:83725648-83725670 CGCACACACATGCTTAGAAAGGG + Intergenic
977468757 4:97415123-97415145 AAAACAGGCCTGCCTATAAAAGG + Intronic
977936679 4:102814037-102814059 TATACAGACAAGCATATAAAGGG - Intronic
978715925 4:111842181-111842203 TACAAAGACATGCCAATGAAAGG - Intergenic
978771796 4:112465083-112465105 CACACACACACACATATAAAAGG + Intergenic
979809252 4:125014682-125014704 CACACACACACACATATAAAGGG - Intergenic
980006285 4:127545916-127545938 CACACACACACACCTCTAAATGG + Intergenic
983029045 4:162775567-162775589 CACACAGAAAAACCTATAAGAGG - Intergenic
983666339 4:170188709-170188731 GACACACACATGCCTATAGTTGG - Intergenic
983855911 4:172644519-172644541 CACACAGACTCGCCAATACATGG + Intronic
983974098 4:173911309-173911331 CACACATACATACATATATATGG - Intergenic
986528223 5:8703900-8703922 CACACAGAGAAGCTTGTAAAGGG + Intergenic
987063373 5:14263727-14263749 CACACATACATGCACATATAGGG - Intronic
987651569 5:20748117-20748139 GACACATTCAGGCCTATAAAGGG - Intergenic
987975469 5:25009830-25009852 CACATACAAATGCCTATTAATGG - Intergenic
988563816 5:32304378-32304400 AACACAGACATACTTATAAATGG + Intronic
988615162 5:32768203-32768225 CAGCCAGACATGCCTCTGAAAGG - Intronic
988743992 5:34113361-34113383 GACACATTCAGGCCTATAAAGGG + Intronic
989027809 5:37087293-37087315 TACACAGAAAAGCCTAAAAAGGG + Intergenic
989955389 5:50352947-50352969 CACACACACACCCCTATAGAAGG - Intergenic
990668364 5:58099067-58099089 TTCACATAAATGCCTATAAAGGG + Intergenic
990783380 5:59392479-59392501 CACACACACATATATATAAAGGG - Intronic
991094390 5:62723912-62723934 TCCACAGAGATGCTTATAAATGG - Intergenic
991452463 5:66767613-66767635 CACACACACATATATATAAAGGG + Intronic
991644565 5:68788768-68788790 CACCCAGAGATGATTATAAAAGG + Intergenic
994457168 5:100025669-100025691 CACACACACATGCCTATGAGGGG - Intergenic
996992681 5:129654939-129654961 AGCACATACATGCATATAAATGG - Intronic
997280104 5:132637298-132637320 CTCAAAGACATGCTTAGAAAGGG - Intronic
997986906 5:138508917-138508939 CACACAGACATGCCTATAAATGG - Intronic
1001336530 5:170802083-170802105 CACACAGTCATGCCAGTAAATGG + Intronic
1001830676 5:174786601-174786623 GAGACAGGCATGGCTATAAAAGG - Intergenic
1002759425 6:190250-190272 CACACACAGATGCCTATGAAAGG - Intergenic
1003119750 6:3309687-3309709 CACACACACATGCTTCTGAAGGG + Intronic
1003837378 6:10086318-10086340 CACACACACACACCTTTAAAAGG - Intronic
1004326882 6:14683285-14683307 CACACACACATATATATAAAGGG + Intergenic
1006063592 6:31443910-31443932 AAAACAGACATGCCAATCAATGG - Intergenic
1007282282 6:40721434-40721456 CAGACAGAGATGCCTGCAAAAGG + Intergenic
1009549065 6:65062868-65062890 CACATAGACATGCATGTATATGG + Intronic
1011911443 6:92445321-92445343 CACACACACACACATATAAAGGG + Intergenic
1013883939 6:114938845-114938867 CACATAGACATGGAGATAAACGG - Intergenic
1015947788 6:138521004-138521026 CATACAGGTATGCCTATAATGGG + Intronic
1016775628 6:147901806-147901828 CACAAAGACATGGGTATGAAGGG - Intergenic
1016796909 6:148127806-148127828 CACACACACATACATATATATGG - Intergenic
1017279048 6:152604152-152604174 CACACACACACACATATAAAGGG - Intronic
1017298320 6:152826322-152826344 CACACAGACACACACATAAAGGG + Intergenic
1017629382 6:156381533-156381555 CACACATACACACTTATAAAAGG + Intergenic
1018958413 6:168429305-168429327 CACACACACATACATATATATGG - Intergenic
1020044344 7:5029429-5029451 CATACAAACATGCCAATACAAGG + Intronic
1020289704 7:6713465-6713487 CATACAAACATGCCAATACAAGG + Intergenic
1021256074 7:18393941-18393963 CACTGAGACATGTCTATGAATGG - Intronic
1022168967 7:27804397-27804419 CACACAGACATACATAAACAAGG - Intronic
1023262712 7:38373899-38373921 CACACACACACGAATATAAATGG - Intergenic
1023316045 7:38938304-38938326 CTCACAGGCATGCCTATTTAGGG - Intergenic
1024416220 7:49110037-49110059 TACACATACATGCCTAGCAAGGG + Intergenic
1024555435 7:50599521-50599543 CACACAGAAATGCAGATAATGGG - Intronic
1025276405 7:57585380-57585402 GATACAGACATGCCTACAAAGGG - Intergenic
1025871854 7:65441666-65441688 CACACAGACATGAAAACAAAAGG + Intergenic
1026444668 7:70473857-70473879 GACACAGTCATGCCTCTCAATGG + Intronic
1026876586 7:73882660-73882682 CACACAGACATACATAAAATAGG + Intergenic
1027308520 7:76928229-76928251 CACACACACATGACTAGAAGAGG + Intergenic
1031223877 7:119009197-119009219 CACACAGACATGCATAGGCAAGG - Intergenic
1034187948 7:149193867-149193889 GACACTGACCTGCCTTTAAAGGG + Intergenic
1034365463 7:150542585-150542607 CACACACACATGCTTATACAGGG - Intergenic
1036823425 8:11957588-11957610 CACACACACATGCCTGGAGATGG - Intergenic
1038879721 8:31595414-31595436 CATACAGTCATGCCTATTTAAGG - Intergenic
1039667979 8:39557229-39557251 CACACACACATACATATAAAGGG - Intergenic
1040023376 8:42760278-42760300 CATACACACATGCATATACACGG + Intronic
1040401488 8:47054140-47054162 CCCTCAGGCATGCCTATAACTGG - Intergenic
1040580671 8:48696237-48696259 CACACAGACATTCCAAGACAAGG - Intergenic
1041028479 8:53711242-53711264 CATACAGACATTCTCATAAAAGG - Intergenic
1041492776 8:58453010-58453032 CACACACACATACATATACATGG - Intergenic
1041800004 8:61788473-61788495 CACACACACACGCATAGAAAAGG - Intergenic
1042738682 8:72018175-72018197 CACACACACATACATATATAGGG - Intronic
1044065877 8:87699663-87699685 CCCACCGACATGTTTATAAATGG + Intergenic
1044809842 8:96048570-96048592 CACACACACATACATATACATGG + Intergenic
1045006543 8:97921120-97921142 AACACAGACAGGCCCAGAAAGGG - Intronic
1045776478 8:105809444-105809466 CAAACAGACAACCCTATATAGGG + Intergenic
1045985230 8:108242210-108242232 TACACAGCCTTGCCTAGAAAGGG - Intronic
1046154787 8:110273992-110274014 TACACAGACATTTCCATAAAGGG - Intergenic
1046704077 8:117431336-117431358 CACACAAACATGGATATTAAAGG + Intergenic
1048312984 8:133340170-133340192 CACACACACACGCATATATATGG - Intergenic
1048537342 8:135309547-135309569 CACAGAGACCTGCCAATAATAGG - Intergenic
1048661852 8:136613122-136613144 CACACATACATGCAAAGAAATGG + Intergenic
1048897774 8:139008990-139009012 CATACAGACATTCAGATAAATGG + Intergenic
1048933124 8:139332343-139332365 CACACATACATATCTATATAGGG + Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1050094863 9:2053543-2053565 CACACAGACACGCCTCTGTAAGG - Intronic
1050627740 9:7523378-7523400 CACACACACGTCCCTATCAAAGG - Intergenic
1050929885 9:11309584-11309606 CAGACAGACATGTCAAAAAAAGG - Intergenic
1051776024 9:20635051-20635073 CACACATGTATGCCTATAATGGG + Intergenic
1051890180 9:21933331-21933353 CAGAGAGACAAGCTTATAAATGG - Intronic
1053558794 9:39167500-39167522 CAAAGATACATGCCAATAAATGG + Intronic
1053603018 9:39630110-39630132 CACAAAGACAAGTCTTTAAATGG - Intergenic
1053822921 9:41987728-41987750 CAAAGATACATGCCAATAAATGG + Intronic
1053860670 9:42383870-42383892 CACAAAGACAAGTCTTTAAATGG - Intergenic
1054138317 9:61451441-61451463 CAAAGATACATGCCAATAAATGG - Intergenic
1054250520 9:62712326-62712348 CACAAAGACAAGTCTTTAAATGG + Intergenic
1054564628 9:66746838-66746860 CACAAAGACAAGTCTTTAAATGG + Intergenic
1054607654 9:67199637-67199659 CAAAGATACATGCCAATAAATGG - Intergenic
1055790410 9:79917356-79917378 CACTCAGCTTTGCCTATAAAGGG - Intergenic
1058047095 9:100368311-100368333 TACACAGAAAAGCCTAAAAAGGG - Intergenic
1058617050 9:106841665-106841687 CACATAGATATGCCTTTAATTGG + Intergenic
1060748702 9:126154798-126154820 CACACAGACATGCCTCTGCCAGG - Intergenic
1062104879 9:134749908-134749930 CACACAGACATACCTAGGACTGG - Intronic
1062488686 9:136793634-136793656 CACACAGACACGGCTACAACGGG - Intronic
1203627566 Un_KI270750v1:38846-38868 GATACAGACATGCCTACAAAGGG - Intergenic
1185770391 X:2761491-2761513 GACACAGACATGCACATAGAGGG + Intronic
1186406319 X:9306901-9306923 CACACACACAAGGTTATAAAAGG + Intergenic
1186494821 X:10003959-10003981 CACACACACAAATCTATAAATGG + Intergenic
1186969891 X:14830435-14830457 CACAAAGACATGTATATAACTGG - Intergenic
1188085065 X:25894023-25894045 TACACAGAAGAGCCTATAAAGGG + Intergenic
1188164177 X:26841404-26841426 CACACAGACACACATATATAAGG - Intergenic
1189044393 X:37574879-37574901 CACACACACACACCTATACAAGG - Intronic
1190461710 X:50683162-50683184 CACACACACATATATATAAAGGG - Intronic
1191699218 X:64021476-64021498 CTCACAGACACGCCCAGAAATGG - Intergenic
1194457039 X:94117560-94117582 CACACATACATACATATATATGG - Intergenic
1196272010 X:113723375-113723397 CAAAGAGACATTTCTATAAAAGG - Intergenic
1196527450 X:116742821-116742843 CACACATTCTTACCTATAAATGG - Intergenic
1197085943 X:122475541-122475563 CACACAGACATGCCAGTGAATGG - Intergenic
1197178443 X:123509185-123509207 CACACACACATACATATATATGG - Intergenic
1197922599 X:131610917-131610939 CACACACACATGCACACAAAAGG - Intergenic
1199181546 X:144861302-144861324 GAAACAGACATGCGTATAGAAGG - Intergenic
1200697090 Y:6370528-6370550 CACACAGACAGGCCACCAAAAGG + Intergenic
1200697642 Y:6375185-6375207 CACACACACATGCACACAAAAGG + Intergenic
1200701088 Y:6403159-6403181 CACACAGACAGGCCACTATAAGG + Intergenic
1200704229 Y:6427930-6427952 CACAGAGACAGGCCAACAAAAGG + Intergenic
1200706475 Y:6447085-6447107 CACACAGACAGGCCACCAAAAGG + Intergenic
1200708331 Y:6462041-6462063 CACACAGACAGGCCAACAAAAGG + Intergenic
1200913565 Y:8551914-8551936 CACACAGATAGGCCAACAAAAGG - Intergenic
1200915698 Y:8569426-8569448 CACACAGGCAGGCCAAAAAATGG - Intergenic
1200920741 Y:8610748-8610770 CACACAGACAGGCCAAAACATGG - Intergenic
1200923488 Y:8633776-8633798 CACACAGACAGGCCACCAAAAGG - Intergenic
1200930748 Y:8694792-8694814 CACACAGACAGGGCAATAAAAGG + Intergenic
1200932007 Y:8705549-8705571 CACACAGACAGGCCACCAAAAGG + Intergenic
1200933575 Y:8719023-8719045 CACACAGACAGGACAACAAAAGG + Intergenic
1200960877 Y:8994752-8994774 CACACAGACAGGCCATCAAAAGG - Intergenic
1200961723 Y:9002025-9002047 CACACAGACAGGCCACCAAAAGG - Intergenic
1200962320 Y:9006958-9006980 CACACAGACAGGCCACCAAAAGG - Intergenic
1201025781 Y:9702667-9702689 CACACAGACAGGCCAACAAAAGG - Intergenic
1201027637 Y:9717623-9717645 CACACAGACAGGCCACCAAAAGG - Intergenic
1201029882 Y:9736778-9736800 CACAGAGACAGGCCAACAAAAGG - Intergenic
1201033024 Y:9761539-9761561 CACACAGACAGGCCACTATAAGG - Intergenic
1201036470 Y:9789514-9789536 CACACACACATGCACACAAAAGG - Intergenic
1201037023 Y:9794171-9794193 CACACAGACAGGCCACCAAAAGG - Intergenic
1201038914 Y:9809647-9809669 CACACAGACAGGCCATTAAACGG + Intergenic
1202138241 Y:21689572-21689594 CACACACACATACATACAAAGGG - Intergenic
1202149362 Y:21830821-21830843 CACACAGACAGGCCAACAAAAGG - Intergenic
1202178098 Y:22116082-22116104 CACACAGACAGGCCACCAAAAGG + Intergenic
1202180976 Y:22139629-22139651 CACACAGACAGGCCACCAAAAGG + Intergenic
1202182327 Y:22150168-22150190 CACACAGACATGTCAACAAAAGG + Intergenic
1202194866 Y:22289697-22289719 CATACACACATGCATACAAAAGG + Intergenic
1202209033 Y:22436234-22436256 CACACAGACATGTCAACAAAAGG - Intergenic
1202210384 Y:22446771-22446793 CACACAGACAGGCCACCAAAAGG - Intergenic
1202213263 Y:22470313-22470335 CACACAGACAGGCCACCAAAAGG - Intergenic
1202242243 Y:22783225-22783247 CACTTAGACATGCCTAAACAAGG + Intergenic
1202395227 Y:24416969-24416991 CACTTAGACATGCCTAAACAAGG + Intergenic
1202475558 Y:25253123-25253145 CACTTAGACATGCCTAAACAAGG - Intergenic