ID: 997989698

View in Genome Browser
Species Human (GRCh38)
Location 5:138533927-138533949
Sequence GAGGCATGTTAGGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 602}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997989689_997989698 4 Left 997989689 5:138533900-138533922 CCCACTCCCTCTGCTACTACCAT 0: 1
1: 0
2: 4
3: 28
4: 314
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602
997989691_997989698 -2 Left 997989691 5:138533906-138533928 CCCTCTGCTACTACCATCTATGA 0: 1
1: 1
2: 0
3: 20
4: 175
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602
997989686_997989698 21 Left 997989686 5:138533883-138533905 CCTCACATTAATGCCACCCCACT 0: 1
1: 0
2: 0
3: 17
4: 129
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602
997989690_997989698 3 Left 997989690 5:138533901-138533923 CCACTCCCTCTGCTACTACCATC 0: 1
1: 0
2: 3
3: 33
4: 462
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602
997989687_997989698 8 Left 997989687 5:138533896-138533918 CCACCCCACTCCCTCTGCTACTA 0: 1
1: 0
2: 3
3: 47
4: 463
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602
997989688_997989698 5 Left 997989688 5:138533899-138533921 CCCCACTCCCTCTGCTACTACCA 0: 1
1: 1
2: 3
3: 51
4: 422
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602
997989692_997989698 -3 Left 997989692 5:138533907-138533929 CCTCTGCTACTACCATCTATGAG 0: 1
1: 1
2: 0
3: 7
4: 106
Right 997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG 0: 1
1: 0
2: 3
3: 53
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997989698 Original CRISPR GAGGCATGTTAGGAGGTGGA TGG Intronic
900570352 1:3355224-3355246 GAGGCCTGGCAGGAGGGGGAGGG + Intronic
901012569 1:6209860-6209882 TAGGCATGGTGGGAGGTGGCAGG + Intronic
902171757 1:14617110-14617132 AAGGCATGCTAGGATGTGGTGGG - Intronic
902194218 1:14785857-14785879 ATGGCACGTGAGGAGGTGGAAGG + Intronic
902872557 1:19323280-19323302 GAGGCTTGTTAGGAGGCTGAGGG + Intronic
903385316 1:22922368-22922390 GAGGCCTGGTAGGAGGTGATTGG - Intergenic
903832491 1:26183428-26183450 GGGACATGGTAGGAGGTGAAGGG + Intronic
905941546 1:41867214-41867236 GTGGCATGAAATGAGGTGGATGG + Intronic
906079741 1:43077405-43077427 GAGGCATGGTGGGTGGGGGAGGG - Intergenic
906549765 1:46654692-46654714 GGGGCCTGTCAGGGGGTGGAGGG - Intronic
906912323 1:49967502-49967524 GGGGCCTGTCAGGAGGTGGGGGG + Intronic
907846142 1:58208902-58208924 GAGTCGTTTTAGGGGGTGGAGGG - Intronic
907942820 1:59105727-59105749 GAAGCAAGTTAGGGAGTGGAGGG - Intergenic
908283459 1:62567536-62567558 GGGGCCTGTTGGGGGGTGGAGGG + Intronic
908868857 1:68584479-68584501 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
910220115 1:84881202-84881224 GAGGCATGGTAGGGGCAGGATGG + Intronic
910823154 1:91373536-91373558 GAGGCCTGGTAGGAGGTGAATGG + Intronic
910849693 1:91637962-91637984 GAGGGATATGAGGAGGTTGAGGG + Intergenic
910953302 1:92674525-92674547 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
911172587 1:94784735-94784757 GGGGCATGGTAGGAGGTGACTGG + Intergenic
911271424 1:95806334-95806356 GAGAGATGTTAAGAGGAGGAGGG - Intergenic
911515243 1:98860203-98860225 GGGGCCTGTTGTGAGGTGGAGGG + Intergenic
911774086 1:101786069-101786091 AAGGCCTGTTGGGAGGTGGAGGG + Intergenic
911832073 1:102563160-102563182 GAGGCCTGTTGTGGGGTGGAGGG + Intergenic
911939226 1:104020351-104020373 GGGGCATGGTAGGAGGTGATTGG - Intergenic
913014886 1:114722700-114722722 GCAGCACGTTAGGAGATGGAAGG + Intronic
914086751 1:144461144-144461166 GTGGCATCTCAGGGGGTGGAGGG - Intronic
914223764 1:145703564-145703586 GAGGCAGGGTAGATGGTGGAAGG - Intronic
915148093 1:153807391-153807413 GAGGGAAGGGAGGAGGTGGAAGG + Exonic
915213896 1:154327907-154327929 GGGGCATGATGGGAGGTGGTGGG + Intronic
915462026 1:156076094-156076116 GGGTCATGTTAGGAGGTCGGAGG + Exonic
916407354 1:164510579-164510601 GGAGCATGTTTGGAGGAGGAGGG - Intergenic
916614965 1:166429904-166429926 AAGGCTAGTTAGGAGGTGGATGG - Intergenic
916814568 1:168338743-168338765 GAAGCATGGTGGGAGGTGAAAGG + Intergenic
916872010 1:168925666-168925688 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
917013679 1:170504792-170504814 GGGGCTTGTCAGGAGGTGGTGGG - Intergenic
917365731 1:174230236-174230258 GGGGCATGTTGTGAGGTGGGGGG + Intronic
918032709 1:180831548-180831570 GGGGCATGTTGGGGGGTGGGGGG - Intronic
918612274 1:186506555-186506577 GGGGCATGTTGGGGGGTGGGGGG - Intergenic
919252856 1:195081797-195081819 GGGGCCTGTTAGGAGGTGATTGG - Intergenic
919472388 1:197995720-197995742 GAATCATGGTAGGAGGTGAAAGG + Intergenic
919511757 1:198473913-198473935 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
919749765 1:201030067-201030089 GAGGAATGTTTTGAGGTGGTGGG + Intergenic
920686118 1:208110194-208110216 GAGGCATGTCAGGAGGGAGGGGG - Intronic
920899145 1:210089031-210089053 GGGGCATGTCAGGGGATGGAGGG - Intronic
921400824 1:214721845-214721867 GGGGCTTGTTGGGAGGTGGGGGG - Intergenic
921424227 1:214983935-214983957 GAGTCATGGTAAGAGGTGAAAGG - Intergenic
924800046 1:247322740-247322762 TAGAAATGTTAGGAAGTGGAGGG - Intronic
1062875404 10:939310-939332 GAGGCCTGTTAGGAGGTTTAGGG + Intergenic
1063512876 10:6663327-6663349 GAGGCCTGTCAGGGGGTGGGGGG + Intergenic
1064119410 10:12605931-12605953 GGGGCATGTTCTGGGGTGGAGGG + Intronic
1064425566 10:15226222-15226244 CCGGCATTTTAGGAGGTGGCTGG + Intronic
1064994131 10:21281603-21281625 GTGGGATGTCAGGATGTGGATGG - Intergenic
1065870614 10:29953147-29953169 GAGGCCTGGTGGGAGGTGGTTGG - Intergenic
1066112210 10:32207466-32207488 GAGTGATGTAAGGAGGTGGGGGG + Intergenic
1066256955 10:33689414-33689436 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
1066965006 10:42255269-42255291 GGGGCTTGTTGGGGGGTGGAGGG - Intergenic
1067085372 10:43235354-43235376 GAGGCAGAATAGGATGTGGAAGG - Intronic
1067209374 10:44246316-44246338 GGGGCATGTTGGGAGGTGGGTGG - Intergenic
1068737582 10:60431636-60431658 GAGGCCTGTTAGCTGGTGGGGGG + Intronic
1069216554 10:65828490-65828512 GAATCATGGTAGGAGGTGAAAGG - Intergenic
1069387048 10:67893299-67893321 GAGGCCTGTCAGGAGGTGGGGGG - Intronic
1069431745 10:68342017-68342039 GCGGCATGAGTGGAGGTGGATGG + Exonic
1069829080 10:71271698-71271720 GAGGCAGGTGAAGAAGTGGATGG - Intronic
1071715551 10:88091800-88091822 GAGTCATGCTTGGAGGTGGAAGG + Intergenic
1072011945 10:91309853-91309875 GAGACATGTGGGGAGGAGGAGGG - Intergenic
1072569763 10:96648239-96648261 GAGGCAGGTGAGGAGGTGGGGGG + Intronic
1075076056 10:119351086-119351108 GAATCATGTTAGGAAGTGGATGG + Intronic
1075189854 10:120297145-120297167 GGGGCATGTTGGGAGGTGATTGG - Intergenic
1076134470 10:128036074-128036096 CAGGGATGTTGGGAAGTGGACGG + Intronic
1077272212 11:1686713-1686735 GAGGCAGGGAAGGAGGGGGAGGG - Intergenic
1077904560 11:6519867-6519889 GTGGCATGTGTGGAGGTGGCAGG + Intronic
1077969130 11:7169363-7169385 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
1078389571 11:10925226-10925248 AAGGAATGTTAGGAGGTGTTTGG + Intergenic
1078421082 11:11213510-11213532 GGGGCTAGATAGGAGGTGGAAGG - Intergenic
1078712810 11:13811979-13812001 GAGTCATGGCAGGAGGTGAAAGG + Intergenic
1078875298 11:15388886-15388908 GGGGCCTGTTAGGGGGTGGGAGG - Intergenic
1079006082 11:16791956-16791978 GAGGGAATTTAGGAGGTGGAAGG - Intronic
1082566594 11:54687097-54687119 GAGTCATGGTGGGAGGTGCAAGG + Intergenic
1082720934 11:56675574-56675596 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
1083726930 11:64633372-64633394 GAGGGATGTTTGGAGGTTGAAGG - Intronic
1085021564 11:73213394-73213416 GAGGAATGTGGGGCGGTGGATGG + Intergenic
1085065442 11:73491182-73491204 GAGGCAGGTTAGGAGCTGATGGG + Intronic
1085299812 11:75451267-75451289 GAGGCAGGTGAGGAGCTGGAAGG + Intronic
1085850624 11:80115336-80115358 AGGGCCTGTTGGGAGGTGGAGGG + Intergenic
1086531030 11:87785227-87785249 GAGGCCTGTCAGGGGGTGGGGGG + Intergenic
1087162048 11:94958675-94958697 GAGGCACTTTAGGAGGTGAGAGG - Intergenic
1088004116 11:104920345-104920367 GGGGCCTGTCAGGAGGTGGAGGG - Intergenic
1088232276 11:107685288-107685310 GGGGCCTGTTGGGAGGTGGTTGG + Intergenic
1088239354 11:107758027-107758049 GAGGCCTGGTAGGAGATGGTTGG + Intergenic
1088533781 11:110838241-110838263 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1088534284 11:110843080-110843102 GAGGCCTATCAGAAGGTGGAGGG - Intergenic
1089238810 11:117056364-117056386 GGGGCCTGTTGTGAGGTGGAGGG + Intronic
1089827376 11:121291022-121291044 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
1089896780 11:121938378-121938400 GAGGCATGCTTGGAGGGGCAGGG - Intergenic
1089934788 11:122352881-122352903 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1091206984 11:133828504-133828526 GAGGGAGGAGAGGAGGTGGAAGG + Intergenic
1092075301 12:5667703-5667725 GGGGCCTGTTGGGAGATGGAAGG - Intronic
1092839700 12:12528162-12528184 GAGGAAGGTTGGGAGGGGGAAGG - Intronic
1092892345 12:12980683-12980705 GAGGCATGTTGGGTGGTGGTGGG + Intronic
1093234073 12:16584597-16584619 GAGGCCTGTTTAGAGGTGGATGG + Intronic
1093334538 12:17886528-17886550 GAGGCATGGTGGGAGGTGATTGG - Intergenic
1093678168 12:21968193-21968215 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1094156194 12:27339113-27339135 GAGGCCTATTGGAAGGTGGAAGG - Intronic
1095039588 12:37426494-37426516 GAGTCATGGTAGGAGGTGAAAGG - Intergenic
1095636054 12:44434909-44434931 GAGGCATGGTAGGGGGTGTTTGG + Intergenic
1095653758 12:44645177-44645199 GAGACAAGTTAGGAGAGGGAGGG + Intronic
1096432278 12:51556605-51556627 GAGGTATGTTTGGATGAGGAAGG - Intergenic
1096653267 12:53072733-53072755 GAAGCAAGTTTGGAGGTGTAAGG + Intronic
1096660469 12:53121038-53121060 CTGGCTTGTCAGGAGGTGGAGGG - Intronic
1098490024 12:71064729-71064751 GAGGGATGATAGAAGCTGGAAGG + Intronic
1099004245 12:77217535-77217557 GAATCATGGTAGGAGGTGAAAGG - Intergenic
1099564411 12:84223533-84223555 GAGACATGTCAGGAGGAGCAAGG - Intergenic
1100947876 12:99807482-99807504 TAGGTATGTCAGGAGGTGGAAGG + Intronic
1101302561 12:103496283-103496305 GAGGCAGATGAGTAGGTGGAAGG - Intergenic
1101466035 12:104950260-104950282 GAGACCTGGTAGGAGGTGGTTGG + Intronic
1101962169 12:109258602-109258624 GAGGCAGGGCAGGAGGTGGGAGG - Intronic
1102266453 12:111490378-111490400 GAGGCTAATTAGGATGTGGAGGG + Intronic
1102494772 12:113311973-113311995 GAGAAATTTTAGGAGGTGGCTGG + Intronic
1104385229 12:128345065-128345087 GAGGCCTGTTAGAGGGTGGTGGG - Intronic
1105200944 13:18176645-18176667 GAGTCAGGGTGGGAGGTGGAGGG - Intergenic
1105925866 13:25007409-25007431 ACGGCCTGTTGGGAGGTGGAGGG - Intergenic
1106341776 13:28836676-28836698 GAGGCATTCTAGGAGGAGGCAGG + Intronic
1106347955 13:28897889-28897911 GGGGCCTGTTGTGAGGTGGAGGG + Intronic
1106470364 13:30049016-30049038 GAGGCATGTTAGAAAGAGGAAGG + Intergenic
1106651315 13:31693219-31693241 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1106889676 13:34231360-34231382 GGGGCCTGTTGGGAGGTTGAGGG - Intergenic
1107044003 13:35976181-35976203 GAGGCAGGTTGGGAGGAGAAAGG + Intronic
1107580590 13:41780076-41780098 GAAGCATGTAAGAAGGTAGAAGG - Intronic
1107927570 13:45278126-45278148 GAGAAATGGTAGGGGGTGGAGGG + Intronic
1108145193 13:47469510-47469532 AGGGCCTGTTAGGGGGTGGAGGG + Intergenic
1108154299 13:47569857-47569879 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
1108412791 13:50166939-50166961 GGGGCCTGTTAGGGGGTGGGGGG + Intronic
1108499850 13:51060092-51060114 AAGGCGTCTTAGGAGGAGGAAGG - Intergenic
1110630730 13:77703584-77703606 GAGGCAGGGTTGGGGGTGGAGGG + Intronic
1110681578 13:78319620-78319642 GGGGTAGATTAGGAGGTGGAAGG + Intergenic
1110914315 13:81002437-81002459 AAGGCATGGTAGGAGGTGTTTGG - Intergenic
1111160989 13:84394476-84394498 GAGGCAGGTGAGGAGGGGCAAGG - Intergenic
1111587621 13:90303196-90303218 GGGGCATGTCAGGGGGTGGGGGG - Intergenic
1111815607 13:93148792-93148814 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1112202549 13:97291094-97291116 GAGGGATGGTAGGAGGAGGAAGG + Intronic
1112594092 13:100792088-100792110 GAATCATGGTAGGAGGTGAAAGG + Intergenic
1113134564 13:107075240-107075262 GAGGCCTGGTAGGAGGTGACTGG - Intergenic
1113239531 13:108320916-108320938 GGGGCATGGTAGGAGGTGACTGG - Intergenic
1113247424 13:108413354-108413376 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1113661244 13:112107694-112107716 GAGTCCTGTGAGGAGGTGGAAGG - Intergenic
1113780005 13:112971118-112971140 GAGGCAAGTTATTAGGTTGAAGG + Intronic
1114011206 14:18370551-18370573 GAGGCCTGTCAGGGGTTGGAGGG + Intergenic
1114140502 14:19904246-19904268 GAGGCCTGTTGTGAGGTGGGGGG + Intergenic
1114869571 14:26639971-26639993 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1115613646 14:35072440-35072462 TAGGCATGGCAGGAGGTGGAAGG + Intronic
1115842243 14:37484995-37485017 GGGGCTTGTCAGGGGGTGGAGGG - Intronic
1116112606 14:40606206-40606228 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1117313397 14:54550751-54550773 GAGTCAGATTAGGAGGAGGAGGG + Intergenic
1117487926 14:56217285-56217307 CAGGCCTGCCAGGAGGTGGAGGG - Intronic
1118088537 14:62446246-62446268 GCGGCCTGTCAGGGGGTGGAGGG - Intergenic
1118504073 14:66391625-66391647 GAGGAATGTTAGAGGTTGGAGGG + Intergenic
1119110647 14:71970817-71970839 GGGGCATGGGAGGAGGTAGAGGG + Intronic
1120510931 14:85413691-85413713 GAGGCCTGTCAGTAGGTGGAGGG + Intergenic
1120753719 14:88222086-88222108 GAGTCATGGTGGGAGGTGAAAGG + Intronic
1120909795 14:89655993-89656015 GAATCATGGTAGGAGGTGAAAGG - Intergenic
1121882270 14:97511509-97511531 GGGGCATGTAAGTAGGAGGAAGG + Intergenic
1122391182 14:101386249-101386271 GAGGCCTGTTTGTGGGTGGAGGG - Intergenic
1122414286 14:101541411-101541433 TAAGCATGTCAGGAGCTGGAAGG - Intergenic
1122878041 14:104677835-104677857 GAGGAAGGGGAGGAGGTGGAAGG - Intergenic
1122880302 14:104687854-104687876 GAGGAATGTGAGGAGGTTGGTGG - Intergenic
1123016339 14:105377338-105377360 GAGGCAGGTGGGGAGGGGGAGGG + Intronic
1123148585 14:106158656-106158678 GAGGCCTGTTGGGAGGTAAAGGG - Intergenic
1123586862 15:21768824-21768846 GGGGCCTGTCAGGAGATGGAAGG + Intergenic
1123623501 15:22211389-22211411 GGGGCCTGTCAGGAGATGGAAGG + Intergenic
1123776675 15:23587660-23587682 GAGGAATGTTAGCATGTGCAGGG + Intronic
1124812041 15:32950677-32950699 GGGGCCTATTAGAAGGTGGAGGG + Intronic
1125341723 15:38682261-38682283 GAGTCATGGCAGGAGGTGAAAGG + Intergenic
1125639080 15:41214620-41214642 GAAGAATGGTAGGAGATGGAAGG - Intronic
1126673755 15:51139614-51139636 GGAGCCTGTTAGGGGGTGGAAGG - Intergenic
1126839546 15:52703681-52703703 GGGGCCTGTTAGGGGGTGGGGGG + Intronic
1127055565 15:55127542-55127564 GGGGCCTATTAGGAGGTGGGGGG + Intergenic
1128091504 15:64922112-64922134 GAGGCAGGTTGGGGGCTGGAGGG - Intronic
1128218501 15:65951053-65951075 TAGGCTTGTTAGGAGGTCCAGGG + Intronic
1128462079 15:67877940-67877962 GGGGCATGGTAGGAGGTGATTGG + Intergenic
1128614194 15:69096572-69096594 GAGAGAGGTTAGGAGGAGGAGGG + Intergenic
1129523456 15:76199896-76199918 GGGGCTTTTTAGGTGGTGGAAGG + Intronic
1129876513 15:78979042-78979064 CAGCCATGTGAGGAGGTGGATGG + Intronic
1130973583 15:88755514-88755536 GGGGCCTGGTAGGAGGTGGTTGG - Intergenic
1131323846 15:91423357-91423379 GAGGCATGGCAGGTGGTAGAGGG + Intergenic
1132249435 15:100323961-100323983 GAGCCATGATAGTGGGTGGAGGG + Intronic
1133267505 16:4593906-4593928 GTGGGATGTCAGGAGGTTGAGGG - Intronic
1133402052 16:5495441-5495463 GAGGCCTGGTAGGAGGTGACTGG - Intergenic
1133859074 16:9577033-9577055 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
1134806837 16:17133151-17133173 GAGGGATGTGAGGAGGTGATGGG + Intronic
1135269739 16:21058826-21058848 GGGGCCTGTTAGGAGGTGGGGGG + Intronic
1135675419 16:24411174-24411196 GTGGCATGTAAGGAGGAGCATGG - Intergenic
1135796655 16:25450552-25450574 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1136261957 16:29083423-29083445 GAGGCATGTGGGATGGTGGATGG + Intergenic
1136398446 16:30005313-30005335 GGGGCATCTTAGGGGGTGGGAGG - Exonic
1136681631 16:31968983-31969005 GAGGCCTGTCAGGAGGTAAAGGG + Intergenic
1136730694 16:32409269-32409291 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
1136781939 16:32910481-32910503 GAGGCCTGTTAGGAGGTAAAGGG + Intergenic
1136887854 16:33943367-33943389 GAGGCCTGTCAGGAGGTAAAGGG - Intergenic
1137020276 16:35418349-35418371 GAGGCCTGTCAGGGGGTGGGGGG + Intergenic
1138183469 16:54959158-54959180 GAGGCCTGATTGGAGGTGGCTGG + Intergenic
1138569206 16:57857548-57857570 GGGGCATGTTAGGGGGTGGGAGG - Intronic
1138757238 16:59503340-59503362 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1139081919 16:63532324-63532346 GAGGCCTGTTATGGGGTGGGGGG - Intergenic
1140826439 16:78711048-78711070 CAGGCATCTTAGAAAGTGGAGGG + Intronic
1140968676 16:79992184-79992206 GAGGCATGCAAGGGCGTGGAAGG - Intergenic
1141495588 16:84407361-84407383 AAGCCATGTGAGGATGTGGATGG + Intronic
1141608512 16:85169053-85169075 GAGGCAGGCTTGGAGGAGGAGGG + Intergenic
1142197691 16:88746275-88746297 GGGGCATGGTAAGAGGTGGGGGG + Intronic
1202995703 16_KI270728v1_random:108000-108022 GGGGCCTGTTGGGGGGTGGAGGG + Intergenic
1203022390 16_KI270728v1_random:420342-420364 GGGGCCTGTTGGGGGGTGGAGGG + Intergenic
1203084595 16_KI270728v1_random:1174471-1174493 GAGGCCTGTCAGGAGGTAAAGGG + Intergenic
1143456133 17:7069253-7069275 GAGGCCTGTTAGGAGATAAATGG - Intergenic
1143730632 17:8880830-8880852 GAGGCCTGGAAGGAGCTGGAAGG - Intronic
1143774096 17:9186462-9186484 GATCCCTGTTGGGAGGTGGAGGG - Intronic
1144070673 17:11668728-11668750 GAGGCATTTGAGAATGTGGAAGG + Intronic
1144095169 17:11893699-11893721 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
1144541122 17:16144604-16144626 GGGGCCTATTAGAAGGTGGAGGG - Intronic
1145378288 17:22371955-22371977 GAGTCATGGTAGGAGGTGAAAGG + Intergenic
1145685929 17:26664004-26664026 GAGGCCTGTTATGGGGTGGGGGG - Intergenic
1146601089 17:34216981-34217003 GAGGCCTGCCAGGAGGTGGGGGG - Intergenic
1146692902 17:34888973-34888995 GAGGTCTGTTAGCAGGTGGATGG - Intergenic
1147811136 17:43170620-43170642 AAGGATTGTTGGGAGGTGGAGGG + Exonic
1148246178 17:46032225-46032247 GAGGCAGGCTGGGGGGTGGAGGG + Exonic
1148560652 17:48604091-48604113 GAGGGATGGCAGGAGGGGGAGGG + Intronic
1149110344 17:53020358-53020380 GAATCATGGTAGGAGGTGAAAGG + Intergenic
1149246238 17:54711751-54711773 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1150161262 17:62900264-62900286 GAGGCCTGGTAGGAGGTGATGGG + Intergenic
1150537829 17:66062078-66062100 CAGTCATGGTAGGAGGTGAAGGG - Intronic
1150581667 17:66479843-66479865 GAGGCCTGTCAGAAGGTGGAGGG + Intronic
1150672338 17:67212007-67212029 GAGGCATGTTGAGAGTTGCAAGG + Intronic
1150996852 17:70328543-70328565 GAGGCCTGTTGGAGGGTGGAGGG - Intergenic
1151266664 17:72961727-72961749 GGGGCCTGTCAGGAGGTGGGGGG + Intronic
1151537432 17:74746836-74746858 GAGTCAGGTTAGGTGGTGGGAGG + Exonic
1151629549 17:75301237-75301259 GAGGCAGATGAGGATGTGGAAGG - Intergenic
1151935164 17:77256861-77256883 GAGGCATGTATGAGGGTGGAGGG + Intergenic
1151974677 17:77477664-77477686 GAGGGAGGTCAGGAGGTGCATGG + Intronic
1152368921 17:79873026-79873048 GAGGCAGATTAGGAAGAGGAAGG - Intergenic
1152614033 17:81329774-81329796 GAGGCCTGTGTGGGGGTGGAGGG - Intronic
1153039280 18:795744-795766 GGGGCCTGTTAGGGGGTGGGGGG + Intronic
1153575671 18:6518255-6518277 GTGGCCTGTCAGGGGGTGGAGGG - Intronic
1153626335 18:7025205-7025227 AAGGCATGGAGGGAGGTGGAAGG - Intronic
1153699097 18:7674462-7674484 GAAGCATGTTGGGAGGAAGATGG + Intronic
1155073549 18:22336357-22336379 GGGGCGTGTGAGCAGGTGGAAGG + Intergenic
1155105737 18:22664100-22664122 GGGGCCTGTTAGAGGGTGGAGGG - Intergenic
1155164900 18:23224257-23224279 GAGGCACCAAAGGAGGTGGATGG - Intronic
1156079821 18:33319193-33319215 GGGGCCTGTCATGAGGTGGAGGG - Intronic
1156237741 18:35220503-35220525 GAGGGAAGTTCGGAGGTGTAGGG - Intergenic
1156250854 18:35351413-35351435 GAGGCCTGGTAGGAGGTGATTGG + Intergenic
1156772628 18:40748128-40748150 GAGGCCTGTTGGGGGGTGGGAGG - Intergenic
1156987327 18:43363221-43363243 GAGGCATGGTGGGAGGAGAATGG - Intergenic
1157068684 18:44381010-44381032 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1157309746 18:46543569-46543591 GAGGCCTGTCAGGGGGTGGGGGG - Intronic
1157337018 18:46748060-46748082 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
1157433580 18:47650787-47650809 GAGGCCTGTGAGGAGATGCAGGG - Intergenic
1157532662 18:48434759-48434781 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1159503707 18:69307013-69307035 GAGGCCTGTCAGGAAGTGGGGGG + Intergenic
1160225998 18:77011399-77011421 GAGCCATTGTAGGAGATGGAGGG - Intronic
1160319274 18:77875138-77875160 GAGGGCTGTGGGGAGGTGGAGGG - Intergenic
1160820730 19:1056527-1056549 GAGGCAGGGTAGGACGTGCAGGG - Intronic
1161097103 19:2398711-2398733 GAGGCCTGTCAGGTGTTGGAGGG - Intronic
1162959084 19:14115828-14115850 GAGGCCAGCTGGGAGGTGGAAGG - Intronic
1164591826 19:29511707-29511729 GAGGAAGGATGGGAGGTGGAGGG + Intergenic
1164857038 19:31532944-31532966 GGGGCCTGTCAGGAGGTTGAGGG - Intergenic
1165052937 19:33154376-33154398 GAGGCCTGTCAGGGGGTGGGAGG - Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166674810 19:44733646-44733668 GAGGCCTGTTGGGATGGGGAGGG - Intergenic
1167599423 19:50445722-50445744 GAGGCATCTTGAGTGGTGGACGG - Intronic
1167837520 19:52086246-52086268 GGGGCCTGGTGGGAGGTGGATGG + Intronic
1167842380 19:52132483-52132505 GGGGCCTGGTGGGAGGTGGATGG + Intronic
1168469232 19:56627469-56627491 AGGGCAGGTCAGGAGGTGGAGGG + Intergenic
925004303 2:429157-429179 GAGGCCTGGTGGGAGGTGGTGGG + Intergenic
926431707 2:12793681-12793703 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
926585389 2:14680257-14680279 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
926974788 2:18503813-18503835 GAGGCATGTTGGGTTGTTGATGG + Intergenic
927064151 2:19453461-19453483 GAGGCCGGTCAGGAGGTGGGGGG + Intergenic
927387657 2:22554068-22554090 TAGTCATGTTTGGAAGTGGAAGG + Intergenic
927981100 2:27375712-27375734 GAGTCGGGTTAGGAGGGGGAAGG + Intronic
928634988 2:33235892-33235914 GGGGCCTGTTGGGAGGTGGTGGG + Intronic
928787221 2:34903216-34903238 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
928808293 2:35189331-35189353 GGGGCATTTCAGAAGGTGGAAGG - Intergenic
929073453 2:38057661-38057683 GGGGCATGGTAGGAGGTGATTGG + Intronic
929431865 2:41893837-41893859 GGCCCAGGTTAGGAGGTGGAGGG + Intergenic
929838575 2:45431616-45431638 GGGGCCTGTCAGGGGGTGGAAGG + Intronic
930625182 2:53688773-53688795 GGGGCCTGTTGGGAGGTGGGGGG + Intronic
931307133 2:61040575-61040597 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
932414602 2:71566030-71566052 GTGGCATGTGAGCAGGTGGATGG - Intronic
932849269 2:75168436-75168458 GAGGCATGGTAGCAGCTGAATGG + Intronic
933095456 2:78173063-78173085 AAGGCATGTGGGGAGGTGGAGGG - Intergenic
933535891 2:83574134-83574156 GAGGCCTGATAGGAGGTGATCGG - Intergenic
933547924 2:83738789-83738811 GGGGCCTGTTGGGGGGTGGATGG + Intergenic
934116525 2:88802214-88802236 GAGTCAGGGCAGGAGGTGGAGGG + Intergenic
934315025 2:91909980-91910002 GGGGCCTGTTGGGGGGTGGAGGG + Intergenic
934702216 2:96451546-96451568 GTGGCATGCTGGGAGCTGGACGG - Intergenic
934785298 2:97000788-97000810 GGGGCCTGTCAGGGGGTGGAGGG - Intronic
934962319 2:98687546-98687568 GAAGAATATTAGGAGGGGGAAGG - Intronic
935690989 2:105732444-105732466 GAGTAAAGTTGGGAGGTGGAAGG - Intergenic
936256522 2:110919395-110919417 GGGGCCTGTTAGGGGGTGGGGGG + Intronic
936788702 2:116125013-116125035 GAATCATGGTAGGAGGTGAAAGG - Intergenic
936854355 2:116938457-116938479 GGGGCCTGTTGGGAGGTGGCGGG - Intergenic
938151502 2:128889186-128889208 TGGGCATGTAAGCAGGTGGAGGG - Intergenic
938186038 2:129232765-129232787 GGGGCCTGTCAGGCGGTGGAGGG + Intergenic
938203336 2:129395658-129395680 GAGGCCTGTTGGGGGGTGGGGGG + Intergenic
938665815 2:133535277-133535299 GAGGGAGGATGGGAGGTGGAAGG - Intronic
939189309 2:138897424-138897446 CAGGCATGCCAGGAGGTGGTGGG + Intergenic
939190651 2:138913055-138913077 GGGGCATGTCAGGGGGTGGGGGG + Intergenic
939810576 2:146826666-146826688 GAGGCCTGTTGGGAGGTGTTTGG - Intergenic
940741129 2:157509154-157509176 CTGGCATGTTAGGGGCTGGAGGG - Intergenic
940989980 2:160086977-160086999 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
941468245 2:165855194-165855216 GAGGCATGGAAGGAGCAGGAAGG - Intergenic
942097192 2:172544704-172544726 GAGGCCTGTTGAGGGGTGGAGGG + Intergenic
942401247 2:175605922-175605944 GGGGCAAGGTGGGAGGTGGAGGG - Intergenic
942555813 2:177171268-177171290 GAGGGATGTTAGCATGTGCAGGG + Intergenic
943088887 2:183350592-183350614 CAGGCATGTAAGAAGGTGGCAGG - Intergenic
943427244 2:187752024-187752046 GAAGCATGGCAGGAGGTGAAAGG + Intergenic
943993529 2:194730158-194730180 GGGGCCTGTTGGAAGGTGGAGGG + Intergenic
945191461 2:207192262-207192284 GAGGCTTGTTGGAGGGTGGAGGG - Intergenic
945986981 2:216362856-216362878 GATGCATCTCAGGAGGGGGATGG + Intronic
946683096 2:222238589-222238611 CAGACATGGGAGGAGGTGGAGGG + Intronic
946825300 2:223671791-223671813 GAATCATGGTGGGAGGTGGAAGG - Intergenic
947093812 2:226543642-226543664 GAATCATGGTAGGAGGTGAAAGG - Intergenic
947319109 2:228896916-228896938 GAGGCCTGGTAGGAGGTGATTGG + Intronic
947896285 2:233676177-233676199 GAGGCATGGTGGGAGGTGGCTGG - Intronic
948025286 2:234771565-234771587 GAGGAAGGTAGGGAGGTGGATGG + Intergenic
948097624 2:235349068-235349090 GAGGCCTGCTAGGAGGTGATTGG + Intergenic
948106876 2:235421553-235421575 GAGTCAGGTTAGGGGGAGGAAGG - Intergenic
948566656 2:238891586-238891608 GAGGCATGTGAACAGGGGGACGG + Intronic
949041806 2:241853033-241853055 GAGGGATGTGAGCAGGTGGCCGG - Intronic
1169266996 20:4172775-4172797 GAGGGATTTTAGGGGCTGGAGGG + Intronic
1169464722 20:5827305-5827327 GAGGCCTGGCAGGAGGTGGAAGG - Intronic
1169917206 20:10695545-10695567 GAGGCAAGTTAGGAGAAGGGGGG + Intergenic
1170847483 20:19974691-19974713 GAGGCCTATGGGGAGGTGGAAGG - Exonic
1171442019 20:25172249-25172271 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1171571352 20:26254600-26254622 GAGTCATGGTAGGAGGTGAAAGG - Intergenic
1172292156 20:33784186-33784208 GAGGGAGGTGAGGAGGCGGAGGG - Intronic
1172780868 20:37436349-37436371 GATGCATGATGGGGGGTGGATGG - Intergenic
1172848560 20:37944635-37944657 GAGGGATGGTAGGAGGAGGGAGG - Exonic
1173090817 20:39969319-39969341 GGGGCCAGTTGGGAGGTGGAGGG - Intergenic
1173352457 20:42257515-42257537 GGGGCCTGGTAGGAGGTGGTTGG + Intronic
1173480956 20:43399030-43399052 GAGGCATGGAAGGAGGTTGTGGG - Intergenic
1174574959 20:51530740-51530762 GTGGCTTGTTAGGAGATGTAAGG - Intronic
1174751881 20:53119083-53119105 GAGGCCTGGTGGGAGGTGGTTGG - Intronic
1175940895 20:62537061-62537083 GAGGCCTGTGTGGAGGCGGAGGG + Intergenic
1176678951 21:9807817-9807839 GATGCTGGTTAAGAGGTGGAAGG + Intergenic
1176902902 21:14465107-14465129 GAGGCCTGTTGGAGGGTGGAGGG - Intergenic
1177593777 21:23208886-23208908 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
1178117627 21:29433901-29433923 GAGGAATGTGAGGAGGTAGCCGG - Intronic
1178175545 21:30093764-30093786 GGGGCTTGTCAGGAGGTGGGGGG + Intergenic
1178779771 21:35590673-35590695 GGGGCATGTTGGGGGGTGGGGGG + Intronic
1179366629 21:40764939-40764961 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
1180435700 22:15301355-15301377 GAGGCCTGTCAGGGGTTGGAGGG + Intergenic
1180517938 22:16165523-16165545 GAGGCCTGTCAGGGGTTGGAGGG + Intergenic
1180573536 22:16751605-16751627 GAGTCATGGCAGGAGGTGAAAGG - Intergenic
1182550945 22:31100485-31100507 GAGGCGTGAGAGGAGGTGGGGGG - Intronic
949908486 3:8879639-8879661 GAGACACTTTTGGAGGTGGAGGG - Exonic
950404934 3:12798334-12798356 GAGGCATGATGGGAGCTGAAAGG - Intronic
951106253 3:18746777-18746799 GGGGCATGGATGGAGGTGGAGGG + Intergenic
951182329 3:19673012-19673034 GAGGCCTGGTGGGAGGTGAATGG + Intergenic
951424513 3:22528218-22528240 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
951975170 3:28498801-28498823 GAGGCCTGTTGGGGGGTGGCTGG - Intronic
952746908 3:36790332-36790354 GAGGGATTTTAGGAGGTGAGAGG - Intergenic
953009125 3:39007505-39007527 GAGGCATTTTAGGAGGGGAAAGG + Intergenic
954430252 3:50466995-50467017 GAGGCCTGTAAGGGGGTGGGGGG + Intronic
954671999 3:52296209-52296231 GGGGCATGCAAGGAGATGGAAGG + Intergenic
956337903 3:68185366-68185388 GTGGTATGTAAGGAGGTAGAAGG + Intronic
956747971 3:72324380-72324402 GAGGCCAGTTAGGAAGTTGATGG - Intergenic
957354406 3:79062821-79062843 GGGGCCTGTCAGCAGGTGGAAGG + Intronic
957888510 3:86323815-86323837 GGGGCCTGTTGGGAGGTGGGAGG + Intergenic
958868691 3:99531858-99531880 CAGCCATATTAGGAGGTTGAAGG + Intergenic
959154866 3:102654589-102654611 GAGGGATGTTAGAAGATAGAGGG - Intergenic
959408419 3:105990323-105990345 GAGGCTTGGTGGGAGGTGGGAGG - Intergenic
959642907 3:108661474-108661496 GGGGCCTGTTGTGAGGTGGAGGG + Intronic
960035078 3:113094115-113094137 TAGGCATGATAGGAGGAAGAGGG + Intergenic
960265487 3:115616336-115616358 GAGGGATTTTAGGAAGGGGAAGG + Intergenic
960278732 3:115756848-115756870 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
960407195 3:117276396-117276418 GAGGCAAAATAGGAGGTGAAGGG - Intergenic
961437551 3:126929991-126930013 GAGGTATGTTAGGAACTAGATGG - Intronic
961463667 3:127068721-127068743 CAGGCATGGTAGGATGTGGGTGG - Intergenic
962180532 3:133201452-133201474 GGGGCCTGTCAGGAGGTGGTGGG - Intronic
962441478 3:135422418-135422440 GAGGCCTGTTATGGGGTGCAGGG - Intergenic
962555680 3:136548803-136548825 GGGGCCTGGTAGGAGGTGGTTGG + Intronic
963478338 3:145834843-145834865 GGGGCATGTTGTGAGGTGGGGGG + Intergenic
963905601 3:150771274-150771296 GAGGCTGGTGAGGTGGTGGAAGG - Intergenic
964831801 3:160891985-160892007 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
964844952 3:161035073-161035095 GAGGCCTGTCAGGGGGTGGGGGG + Intronic
967351396 3:188517630-188517652 GAATCATGGTAGGAGGTGAAGGG + Intronic
967840038 3:193997838-193997860 AAGTCATCTTAGGAGATGGAAGG - Intergenic
969717971 4:8877547-8877569 GAGGGATGGAAGGAGGGGGAGGG + Intergenic
969738894 4:9009929-9009951 GAGTCAGGATAGGAGGAGGAGGG + Intergenic
971001935 4:22333001-22333023 GAGGCCTGGTAGGAGGTGACTGG + Intergenic
971032806 4:22659383-22659405 CAGGCATCTTGGGAGATGGAAGG - Intergenic
971813029 4:31452445-31452467 GGGGCCTGATAGGAGGTGGCTGG + Intergenic
971916260 4:32873733-32873755 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
972148751 4:36063297-36063319 GGGGCCTGTCAGGAGGTGGGGGG + Intronic
972924278 4:43984306-43984328 GAGGCCTATTGGAAGGTGGAGGG + Intergenic
973010616 4:45068582-45068604 GAGACATGGTAGGAGGTGATTGG + Intergenic
973133142 4:46673107-46673129 GAGGCCTGTTAGGAACTGGGCGG - Intergenic
973156669 4:46963526-46963548 GAATCATGGTGGGAGGTGGAAGG - Intronic
973184974 4:47315874-47315896 GAGGCATACTTGAAGGTGGAGGG + Intronic
974325787 4:60413544-60413566 GGGGCCTGTTGTGAGGTGGAGGG - Intergenic
974827085 4:67144903-67144925 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
974989413 4:69066309-69066331 GAGGCTTTTTAGAGGGTGGAGGG - Intronic
975465796 4:74708123-74708145 GGGGCCTGTTGGGGGGTGGAAGG - Intergenic
975524833 4:75337516-75337538 GGGGCCTGTTGGGAGGTGGGGGG + Intergenic
975948325 4:79736592-79736614 GGGGCCTGTTAGGAGGTGATTGG + Intergenic
976000926 4:80372286-80372308 GAGGCCTGTTGGGAGGTGATTGG - Intronic
976141840 4:82001177-82001199 GAGGCCTGTTTGGAGGTGACTGG + Intronic
976811934 4:89107919-89107941 GAATCATGGTAGGAGGTGAAAGG - Intronic
977049849 4:92116112-92116134 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
977056434 4:92198864-92198886 GAGGCCTATTAGGGGGTAGAGGG - Intergenic
977463524 4:97356048-97356070 GAATCATGGTAGGAGGTGAAAGG + Intronic
977518974 4:98056728-98056750 GGGGCCTGGTAGGAGGTGGTTGG + Intronic
977625324 4:99183720-99183742 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
977646851 4:99422492-99422514 AGGGCCTGTTAGGAGGTGGGGGG + Intronic
978123097 4:105105154-105105176 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
978551612 4:109933574-109933596 GGGGCCTGTTGGGAGGTGGGGGG - Intronic
979016923 4:115446787-115446809 GAGGCCTGTCAGGTGGTGGGGGG - Intergenic
979418981 4:120479867-120479889 GAGGCTTATTGGAAGGTGGAAGG - Intergenic
979421924 4:120515097-120515119 GAGGCATGTCAGGAGTTGTGGGG + Intergenic
979990189 4:127366512-127366534 GAGGTATGTGGGGAGGTGCATGG + Intergenic
980157068 4:129120616-129120638 GAGGCATGTTGGGGGGTGAGGGG - Intergenic
980329297 4:131389714-131389736 GAGGCCTGGTAGGAGGTGTTTGG + Intergenic
980519719 4:133916169-133916191 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
980705520 4:136488194-136488216 GGGGCATGGTAGGAGGTGTTTGG - Intergenic
981412247 4:144446158-144446180 GAAGCCTGTTAGGGGGTGGTGGG + Intergenic
981414195 4:144469770-144469792 GAATCATGGTAGGAGGTGAAAGG + Intergenic
982311295 4:153988069-153988091 GAGGCATGTGAAGAGGGTGAAGG - Intergenic
983179992 4:164636491-164636513 GAGGCCTGTTGGGGGGTGGGGGG + Intergenic
983759653 4:171389078-171389100 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
983851422 4:172585408-172585430 GGGGCGTGTCAGGAGGTGGAGGG - Intronic
984267096 4:177508257-177508279 GAGGAATGTTAGCATGTGTAAGG - Intergenic
984380072 4:178981744-178981766 TAGGCATGTGAGGGGGTGGGGGG + Intergenic
985321902 4:188722138-188722160 GGGGCCTGTTAGAGGGTGGAGGG - Intergenic
986161486 5:5233493-5233515 GTGGCCTGTTGGAAGGTGGAGGG - Intronic
986272117 5:6242467-6242489 GAGGCATATCAGAGGGTGGAGGG + Intergenic
986638517 5:9849041-9849063 GAGGAATGTGAGGAGCTGGGAGG + Intergenic
987745703 5:21968967-21968989 GAGGCTTGATGGGGGGTGGAGGG + Intronic
987830713 5:23091060-23091082 AAGGCCTGTCAGGGGGTGGAGGG + Intergenic
988012668 5:25510768-25510790 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
988241046 5:28609552-28609574 GGGGCCTGATAGGAGGTGGTTGG - Intergenic
988305706 5:29492030-29492052 GGGGCCTGTTAGGGGGTGGAGGG - Intergenic
988430245 5:31110879-31110901 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
988479203 5:31615426-31615448 GAGGCCTGTTGGGGGGTGGGGGG - Intergenic
988772011 5:34441790-34441812 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
988794001 5:34635512-34635534 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
988850093 5:35172359-35172381 GAGGCTTGGTAGGAGGTTGGAGG + Intronic
989359076 5:40578887-40578909 GAGGCCTGTCAGGGGGTGGGGGG + Intergenic
989687161 5:44103792-44103814 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
991296280 5:65084868-65084890 ATGGCATTTTAGGAGGTGGTGGG + Intergenic
991651697 5:68862235-68862257 GAGGAATGCTGGGTGGTGGAAGG + Intergenic
992329595 5:75702151-75702173 GGGGCCTGTCAGGGGGTGGAGGG + Intronic
992440132 5:76790683-76790705 GTGAAATGTTAGGGGGTGGAAGG + Intergenic
993303818 5:86249828-86249850 GAGGCCTGGTAGGAGGTGATTGG - Intergenic
993330826 5:86597827-86597849 GGGGCCTGTTGGGAGGTGGGGGG + Intergenic
993554900 5:89324231-89324253 GAGGCTTGTTGGGAGAGGGAAGG - Intergenic
993636206 5:90346950-90346972 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
994919315 5:106022422-106022444 GGGGCATTTTAGGAAGTTGAAGG - Intergenic
994956463 5:106539509-106539531 GGGGCCTGTCAGGGGGTGGAAGG - Intergenic
994990790 5:106994460-106994482 GGGGCCTGTTGGGTGGTGGAGGG - Intergenic
995150034 5:108832359-108832381 GATGCAGGTTAAGATGTGGATGG + Intronic
995340391 5:111052262-111052284 GAGGCCTATTGGGAGGTGGGGGG - Intergenic
995349976 5:111163932-111163954 GAGGCAAGTGAGGGGGTGGGAGG + Intergenic
995612901 5:113929397-113929419 GGGGAATGTTGGGGGGTGGAGGG - Intergenic
995628982 5:114112317-114112339 GGGGCCTGTTTGGAGGTGGGGGG + Intergenic
996125688 5:119723046-119723068 GGGGCCTGTTGGGAGGTGGGAGG - Intergenic
996227484 5:121018253-121018275 GGGGCCTGTTAGGAGGTGTTTGG - Intergenic
997250426 5:132384659-132384681 GCGGCATGGTTGGAGGAGGAGGG + Intronic
997625277 5:135327038-135327060 GACGCGTGTGAGGAGGTGGCGGG - Intronic
997751046 5:136346076-136346098 GAGGCCTGTTGTGGGGTGGAGGG + Intronic
997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG + Intronic
998026373 5:138819823-138819845 GGGGCATGGTAGGAGGTGATTGG + Intronic
998477960 5:142437230-142437252 GAGGTATATAAAGAGGTGGAAGG - Intergenic
998638437 5:143982999-143983021 GAGGCCTGTTGGGGGGTGGGGGG - Intergenic
998889495 5:146730712-146730734 GAAGCATGTCAGGAGGTGAAAGG - Intronic
999214416 5:149920002-149920024 GAGGGATGTTAGAAGGCAGAGGG + Intronic
999288288 5:150407104-150407126 GAGGGATGGTGGGAGGTGGGGGG + Intronic
999327061 5:150650096-150650118 GAGGCAGGGCAGGAGATGGAGGG - Exonic
999400751 5:151262578-151262600 AAGGCTTGGTAGGAGGTGCAGGG - Intronic
999580789 5:153036546-153036568 CAGGCCTGTAAGGAGGTGGGGGG + Intergenic
999584963 5:153080183-153080205 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
999620805 5:153471280-153471302 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
1000249688 5:159482216-159482238 GGGGCTTATTAGCAGGTGGAGGG - Intergenic
1000653268 5:163844575-163844597 GAGGCCTGTTGGAAGGCGGAGGG + Intergenic
1001746954 5:174099465-174099487 GAGGCATGTTTGCAGGGGGATGG - Intronic
1002659011 5:180777691-180777713 GAGGGATGATGGGTGGTGGATGG - Intergenic
1003439596 6:6126998-6127020 GAGCCATGCTAGGTGGGGGAGGG - Intergenic
1003734584 6:8864312-8864334 GGGGCTTGTTGGAAGGTGGAGGG + Intergenic
1004062272 6:12209148-12209170 GGGGGATGGTAGGAGGTGGATGG - Intergenic
1004234780 6:13864846-13864868 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1004829484 6:19462144-19462166 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
1005946998 6:30602399-30602421 GGGGCATGGTTGGAGGTGGTGGG - Exonic
1006191375 6:32211643-32211665 AAGGTATGTGAGGAGGAGGAAGG + Intronic
1006780936 6:36631811-36631833 GAGGCATGTGAGCAGCTGGAGGG + Intergenic
1007298637 6:40848745-40848767 GAAGAATGTGAAGAGGTGGAGGG - Intergenic
1007448617 6:41926172-41926194 GAGGACAGTTAGGAGCTGGATGG - Intronic
1009265137 6:61544919-61544941 GGGGCCTGTTGTGAGGTGGAGGG + Intergenic
1009355357 6:62738395-62738417 GGGGCCTGTCGGGAGGTGGAGGG - Intergenic
1009768507 6:68114291-68114313 GAGGCATGCCAGGAAGAGGAGGG - Intergenic
1009857895 6:69288199-69288221 GGGGCCTGTTAGCGGGTGGAGGG - Intronic
1010822137 6:80428024-80428046 GAGGCCTGTGAGGGGGTGGGGGG - Intergenic
1010865607 6:80973752-80973774 GAGGCCTGTTGGGAGGTGATTGG + Intergenic
1010973786 6:82290755-82290777 GAATCATGGTAGGAGGTGAAAGG + Intergenic
1011066186 6:83328305-83328327 GGGGCATGTCAGGGGGTGGAAGG + Intronic
1011120895 6:83951436-83951458 GAGGCCTGTTGGGCGGTGGAGGG - Intronic
1011736655 6:90317323-90317345 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1012008153 6:93743104-93743126 GAGGCCTATTAGAGGGTGGAGGG + Intergenic
1012067389 6:94565304-94565326 GAATCATGGCAGGAGGTGGAAGG - Intergenic
1012186244 6:96220661-96220683 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
1012503355 6:99915490-99915512 GAGGCCTGTCAGCAGGTTGAGGG - Intergenic
1012799601 6:103807828-103807850 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1012832284 6:104219302-104219324 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
1014493071 6:122086665-122086687 GAGGCATGGTGGGAGGTGTTTGG - Intergenic
1014700897 6:124686569-124686591 GAGGCCTGGTAGGAGGTGATTGG - Intronic
1015460144 6:133481089-133481111 GAGTCAGGTTTGCAGGTGGAGGG + Intronic
1015706989 6:136098927-136098949 GAGGCCTGTTGGGGGGTGGGGGG - Intronic
1016264441 6:142214525-142214547 GAGGCCTGGTAGGAGGTGAGTGG - Intronic
1016398405 6:143651678-143651700 GGGGCCTGTTAGGGGGTGGGAGG + Intronic
1017038121 6:150285425-150285447 GAGGTAGGGTAGGGGGTGGATGG - Intergenic
1017057428 6:150450360-150450382 GGGGCCTGTTGGGGGGTGGAGGG + Intergenic
1017711023 6:157168114-157168136 GAGGCCAGAAAGGAGGTGGAAGG - Intronic
1018281100 6:162186632-162186654 GGGGCATGGTGGGAGGTGGTTGG + Intronic
1018944312 6:168335531-168335553 AGGACATGTTAGGAGGTGGTGGG - Intergenic
1019015221 6:168875376-168875398 GGAGCATGTTAGGAGGTGCTGGG + Intergenic
1019776136 7:2913066-2913088 GAGGGAAGTGAGGAGGGGGAGGG + Intronic
1019815192 7:3194782-3194804 AAGGTCAGTTAGGAGGTGGAGGG + Intergenic
1019941568 7:4296149-4296171 GAGGCCTGTCAGGGGGTGGGGGG - Intergenic
1020343641 7:7139748-7139770 GAGGCCTGTTGTGGGGTGGAGGG - Intergenic
1020757741 7:12225019-12225041 GAGGCCTGTCGTGAGGTGGAGGG - Intronic
1021656586 7:22879961-22879983 GAGTCATGGTGGGAGGTGAAAGG - Intergenic
1022018738 7:26377459-26377481 GAGACATGTAATGGGGTGGAGGG + Intergenic
1022139405 7:27480225-27480247 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1022527221 7:31046073-31046095 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1022549577 7:31226399-31226421 GAATCATGTCAGGAGGTGAAAGG - Intergenic
1023014897 7:35956982-35957004 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1023137320 7:37065363-37065385 GAGGGATGGAAGGAGATGGAAGG - Intronic
1024213724 7:47228799-47228821 GAGGCGGGGTTGGAGGTGGAGGG - Intergenic
1024213733 7:47228821-47228843 GAGGCGGGTTTGGAGGTGGAGGG - Intergenic
1024213777 7:47228941-47228963 GAGGCAGGTTTGGAGGGAGACGG - Intergenic
1024601960 7:50990212-50990234 GAGGCCTGTTAGGGGCTGGGGGG - Intergenic
1024769188 7:52698275-52698297 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1025285651 7:57658637-57658659 GAGTCATGGTAGGAAGTGAAAGG - Intergenic
1025843527 7:65174565-65174587 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
1025870637 7:65429503-65429525 GGGGCCTATCAGGAGGTGGAGGG + Intergenic
1025879518 7:65521402-65521424 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1025893920 7:65681186-65681208 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
1026141806 7:67713046-67713068 CAGCCATGCCAGGAGGTGGAGGG - Intergenic
1026295126 7:69044891-69044913 GAATCATGGCAGGAGGTGGAAGG + Intergenic
1026664648 7:72331857-72331879 GGGGCCTGTTAGAGGGTGGAGGG - Intronic
1027265576 7:76493556-76493578 GAGGTATGTAAGGAGGTGGATGG + Intronic
1027316947 7:76991673-76991695 GAGGTATGTAAGGAGGTGGATGG + Intergenic
1027571037 7:79867394-79867416 GAGGCCTGTCAGAGGGTGGAGGG + Intergenic
1028218293 7:88162333-88162355 GAGGGATGTGATGAGGAGGAGGG + Intronic
1028752156 7:94394074-94394096 AAGGCAAGCTAGGAGGTCGAAGG + Intergenic
1029421826 7:100475939-100475961 GAGGCATGAGGGGACGTGGAAGG + Intronic
1029480248 7:100807932-100807954 GATGCAGTTTAGGAAGTGGACGG - Intronic
1030007381 7:105132617-105132639 CAGGCATCTTAAGAAGTGGAAGG - Intronic
1030355316 7:108535542-108535564 GAGGCCTGGTAGGAGGTGATTGG - Intronic
1030912966 7:115275862-115275884 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1030985707 7:116239212-116239234 GAGGCATGTGAGGTGCAGGAAGG - Intronic
1031293008 7:119963333-119963355 GAGGCCTGTTGTGGGGTGGAGGG + Intergenic
1031459555 7:122029992-122030014 GAGACATGTTTGGAAGTGAAGGG - Intronic
1032670934 7:134081781-134081803 GAAGCAGGTTTGGAGGTGAAGGG + Intergenic
1032866745 7:135933466-135933488 CTGGCAAATTAGGAGGTGGAGGG - Intronic
1034184074 7:149160981-149161003 GAGGCCTGTCAGGAGGAGGTGGG + Intronic
1035044504 7:155954792-155954814 CAGCCCTGTCAGGAGGTGGAGGG - Intergenic
1036655951 8:10677621-10677643 GAGGTTAGTTAGGAGGTGGTGGG - Intronic
1036658950 8:10695485-10695507 GAGCCATGTTAGGATGTGCTGGG - Intronic
1036728818 8:11243808-11243830 GAGGCATGGTAGGGGGTGCTGGG + Intergenic
1037392414 8:18407704-18407726 GAGGCTTGTTGGGAGGTGAATGG + Intergenic
1038023554 8:23570070-23570092 GGGGCAGGTTGGGAGGTGGGCGG + Intronic
1039442353 8:37603784-37603806 CAGGCAAGCTAAGAGGTGGAGGG - Intergenic
1040433343 8:47365416-47365438 GAGGCATGCTAAGATGTGCATGG - Intronic
1041115381 8:54530835-54530857 GAGGCAGATTAGGAGCTAGAAGG + Intergenic
1041269614 8:56098597-56098619 GAGGCCTGGTAGGAGGTGTTTGG + Intergenic
1041347822 8:56919631-56919653 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1041418565 8:57641818-57641840 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
1041768092 8:61441395-61441417 GAGGAATCTTAGTAGATGGAGGG + Intronic
1041929369 8:63270103-63270125 GAGGTACGTTAGGAAGAGGAGGG - Intergenic
1042074730 8:64979777-64979799 GGGGCATGTTGTGTGGTGGAGGG - Intergenic
1042165579 8:65942631-65942653 GAGGTAGGTTAGCAGGTAGAGGG - Intergenic
1042196602 8:66236618-66236640 GAGGCCTGTTGGGAGGTGGAGGG + Intergenic
1044131474 8:88528952-88528974 GGGGCCTGTTGGGGGGTGGAAGG + Intergenic
1045889269 8:107135085-107135107 GAGGCCTGGTAGGAGGTGACTGG + Intergenic
1046153831 8:110261772-110261794 GGGGCATGTTGTGGGGTGGAGGG + Intergenic
1046925895 8:119788077-119788099 GGGGCCTGTCAGGAGGTGGGGGG + Intronic
1047126706 8:121970296-121970318 GGGGAATGTAAGGAGGTGGAGGG + Intergenic
1047930067 8:129719022-129719044 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1048142045 8:131804138-131804160 GGGGCAGGGTTGGAGGTGGAGGG + Intergenic
1048171370 8:132109837-132109859 AAAGCATTTTGGGAGGTGGAAGG + Intronic
1048411765 8:134182401-134182423 GGGGCCTGTTAGGGGGTGGGAGG - Intergenic
1048437705 8:134433340-134433362 GAGCCAGGTCAGGAGGAGGAAGG + Intergenic
1048600568 8:135915165-135915187 GGGGCCTGTTTGAAGGTGGAGGG + Intergenic
1048698932 8:137063815-137063837 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1048766097 8:137846205-137846227 GGGAAATGTTATGAGGTGGACGG + Intergenic
1050630594 9:7554612-7554634 CAGGCATGTTAGAGGGTGGAGGG + Intergenic
1050930739 9:11321978-11322000 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
1051338574 9:16090405-16090427 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1051549282 9:18311193-18311215 GAGGCCTGTCAGGGGGTGGGGGG + Intergenic
1051858086 9:21592481-21592503 TAGCCTTGGTAGGAGGTGGAAGG + Intergenic
1051922252 9:22280981-22281003 GAGGCCTGGTAGGAGGTGACTGG - Intergenic
1051951040 9:22633155-22633177 GGGGCCTGTTGGGAGGTGGAGGG + Intergenic
1052864257 9:33455465-33455487 GAGGCACTTTGGGAGGTGGGTGG + Intergenic
1053704436 9:40736204-40736226 GAGGCCTGTCAGGGGTTGGAGGG - Intergenic
1053724804 9:40988560-40988582 GAGGCCTGGTAGGAGGTGTTTGG + Intergenic
1054414521 9:64859814-64859836 GAGGCCTGTCAGGGGTTGGAGGG - Intergenic
1056347081 9:85707902-85707924 GAGGCCTGTTCGGGGGTGGGGGG + Intronic
1056971844 9:91211235-91211257 GGGGTATTTTGGGAGGTGGAAGG - Intergenic
1057875100 9:98747721-98747743 AAGACCAGTTAGGAGGTGGAGGG - Intronic
1058549391 9:106097698-106097720 GCGGCCTATTAGGGGGTGGAGGG + Intergenic
1058984922 9:110201369-110201391 GAGGCAGATTCTGAGGTGGAGGG - Exonic
1059586402 9:115612098-115612120 GAGCTGTGTTAGGAGATGGATGG - Intergenic
1059771840 9:117434063-117434085 GAGGTATGTTTGGGGGTGGGGGG + Intergenic
1060452616 9:123757086-123757108 AAGGCATGTTCTGAGGTGGGAGG - Intronic
1062469760 9:136697114-136697136 GAGGGATGATAGGAGGGGGAAGG - Intergenic
1203583410 Un_KI270746v1:37296-37318 GAGTCAGGGTGGGAGGTGGAGGG + Intergenic
1203664123 Un_KI270754v1:10353-10375 GATGCTGGTTAAGAGGTGGAAGG + Intergenic
1185911865 X:3988890-3988912 GAGGCCTGTCAGGGGGTGGGGGG - Intergenic
1185917674 X:4053897-4053919 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1186356122 X:8792292-8792314 GAAGCATTTTAGGAAGGGGAGGG + Intronic
1187709227 X:22037355-22037377 GAGGGATGGTGGGAGGTGAATGG - Intronic
1187753159 X:22489605-22489627 GTGGCCTGTTAGGGGGTGGGGGG + Intergenic
1188000363 X:24974642-24974664 GGGGCATGTTGGGGGGTGGGGGG + Intronic
1188104815 X:26137230-26137252 GGGGCCTTTTAGAAGGTGGAGGG + Intergenic
1188315891 X:28672955-28672977 GGGGCATTTCAGAAGGTGGAGGG - Intronic
1188395310 X:29675533-29675555 GAAGAACTTTAGGAGGTGGAGGG + Intronic
1188778864 X:34254937-34254959 GGGGCCTGTTAGGGGGTGGGGGG + Intergenic
1189655326 X:43239055-43239077 GAAGCATTTTAGGAGGTGAGAGG - Intergenic
1190047056 X:47120696-47120718 GATGCATGTTCAGAAGTGGATGG - Intergenic
1190150537 X:47943868-47943890 GAGGCCTGTGAGGATGGGGAGGG - Intronic
1190485904 X:50924753-50924775 GAGGCCTGTTTGGGGGTGGGGGG - Intergenic
1190551090 X:51581643-51581665 AGGGCCTGTTAGGAGGTGGAGGG + Intergenic
1191728455 X:64306862-64306884 GAGGCAGTTGAGGAGGAGGAAGG - Intronic
1191872413 X:65759562-65759584 GGGGCCTGTCAGGAGGTGGGGGG - Intergenic
1191878421 X:65820348-65820370 GAGGCCTGTTGGGGGGTGGGGGG + Intergenic
1192024757 X:67437667-67437689 GAGGCTTCTGAGAAGGTGGACGG - Intergenic
1192678084 X:73221375-73221397 GGGGCCTGTTAGGGGGTGGGGGG - Intergenic
1192875606 X:75226311-75226333 CTGGCATGTTAGGAGATAGAAGG - Intergenic
1192920251 X:75698569-75698591 GAGGCCTGTCATGAGGTGGGAGG + Intergenic
1193040677 X:77000572-77000594 AAGGCCTGTTAGGAGGTGGGGGG + Intergenic
1193227909 X:79007572-79007594 GGGGCCTGTCAGGGGGTGGAGGG - Intergenic
1193527956 X:82617003-82617025 GGGGCCTGTGAGGGGGTGGAGGG - Intergenic
1194428353 X:93768281-93768303 CAGGCATTTCAGGAGATGGAGGG - Intergenic
1194958521 X:100208959-100208981 GGGGCCTGTTGGGAGGTGGGAGG - Intergenic
1195141364 X:101963864-101963886 GAGGCATTATAGGAGCTGTAGGG - Intergenic
1196232216 X:113237502-113237524 GGGGCCTGTTGGGAGGTGGGGGG - Intergenic
1196602337 X:117616857-117616879 GGGGCCTTTTAGGGGGTGGAGGG - Intergenic
1197072399 X:122314690-122314712 GAGTCATGGTGGGAGGTGAAAGG - Intergenic
1197516095 X:127431436-127431458 GGGGCCTGTTGGGAGGTGGTGGG - Intergenic
1197671845 X:129285730-129285752 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1198066529 X:133102981-133103003 GGGGCCTGTTGGGGGGTGGATGG - Intergenic
1198179681 X:134194107-134194129 GGGGCCTGTCAGGAGGTGGGGGG + Intergenic
1198869144 X:141157272-141157294 GGGGCCTGTCAGGGGGTGGAGGG + Intergenic
1199122244 X:144069406-144069428 GGGGCATGTCAGGGGGTGGAGGG - Intergenic
1200151187 X:153952252-153952274 GGAGCACGGTAGGAGGTGGACGG - Intronic
1200328496 X:155268020-155268042 GGGGCCTGTTGGGGGGTGGAGGG - Intergenic
1200810587 Y:7480372-7480394 GGGGCCTGTTATGGGGTGGAAGG - Intergenic
1201313915 Y:12624173-12624195 GGGGCCTGTCATGAGGTGGAGGG - Intergenic
1201475235 Y:14374594-14374616 GAGACATGGTGGGAGGTGGTTGG + Intergenic
1201623033 Y:15981174-15981196 GTTCCATGATAGGAGGTGGAGGG + Intergenic