ID: 997997185

View in Genome Browser
Species Human (GRCh38)
Location 5:138596378-138596400
Sequence CAGAAGTAGGAGTGGACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997997177_997997185 30 Left 997997177 5:138596325-138596347 CCTACTCTCTGTGACTATCCTCT No data
Right 997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG No data
997997178_997997185 12 Left 997997178 5:138596343-138596365 CCTCTCTGACCTCCTCTATTTAA No data
Right 997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG No data
997997179_997997185 3 Left 997997179 5:138596352-138596374 CCTCCTCTATTTAAATAGCCCAA No data
Right 997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG No data
997997180_997997185 0 Left 997997180 5:138596355-138596377 CCTCTATTTAAATAGCCCAAATT No data
Right 997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997997185 Original CRISPR CAGAAGTAGGAGTGGACCTG AGG Intergenic
No off target data available for this crispr