ID: 997999141

View in Genome Browser
Species Human (GRCh38)
Location 5:138610362-138610384
Sequence GGCACACGCCACCGCGCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997999131_997999141 13 Left 997999131 5:138610326-138610348 CCTCCTGCCTCAGTCTCCCAAGT 0: 315
1: 6029
2: 16316
3: 65391
4: 132266
Right 997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG No data
997999138_997999141 -3 Left 997999138 5:138610342-138610364 CCCAAGTAGCTGGGACTCCGGGC No data
Right 997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG No data
997999139_997999141 -4 Left 997999139 5:138610343-138610365 CCAAGTAGCTGGGACTCCGGGCA No data
Right 997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG No data
997999130_997999141 29 Left 997999130 5:138610310-138610332 CCTGGGCTCAAGTGATCCTCCTG 0: 5667
1: 20854
2: 87258
3: 198358
4: 294179
Right 997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG No data
997999134_997999141 6 Left 997999134 5:138610333-138610355 CCTCAGTCTCCCAAGTAGCTGGG 0: 3760
1: 98786
2: 209641
3: 248249
4: 259645
Right 997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG No data
997999132_997999141 10 Left 997999132 5:138610329-138610351 CCTGCCTCAGTCTCCCAAGTAGC 0: 2981
1: 82617
2: 183650
3: 220674
4: 223119
Right 997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997999141 Original CRISPR GGCACACGCCACCGCGCGCT TGG Intergenic
No off target data available for this crispr