ID: 998005254

View in Genome Browser
Species Human (GRCh38)
Location 5:138652523-138652545
Sequence CCTCCTGGACTGAAAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998005254_998005262 4 Left 998005254 5:138652523-138652545 CCCTGTGCTTTCAGTCCAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 236
Right 998005262 5:138652550-138652572 CTGGTACTCATCTGTCCTGAGGG 0: 1
1: 1
2: 1
3: 16
4: 119
998005254_998005261 3 Left 998005254 5:138652523-138652545 CCCTGTGCTTTCAGTCCAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 236
Right 998005261 5:138652549-138652571 CCTGGTACTCATCTGTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 180
998005254_998005263 5 Left 998005254 5:138652523-138652545 CCCTGTGCTTTCAGTCCAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 236
Right 998005263 5:138652551-138652573 TGGTACTCATCTGTCCTGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998005254 Original CRISPR CCTCCTGGACTGAAAGCACA GGG (reversed) Intronic
900012806 1:131377-131399 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
900042870 1:487364-487386 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
900064307 1:722361-722383 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
900380568 1:2381944-2381966 CCTCCTGGGCTGACAGCACCAGG - Intronic
901087433 1:6619979-6620001 CCTGCTGGACAGAAAGAAAACGG + Exonic
901907721 1:12428694-12428716 CCTGCTGTAATGGAAGCACACGG - Intronic
902691849 1:18114891-18114913 CTTACTGGCCTGTAAGCACATGG - Intronic
903133611 1:21294662-21294684 CCTCCTGGCCTGGTAGCACCTGG + Intronic
904235675 1:29115499-29115521 GCTTCTGGACTGATAACACAGGG - Intronic
904294127 1:29506811-29506833 GATCCTGTCCTGAAAGCACAAGG - Intergenic
906274134 1:44503806-44503828 CCTACTGAACTGAAAGCTCTGGG + Intronic
906568101 1:46814732-46814754 CCTGCTGGACTGTAAGCATCTGG - Intronic
906773396 1:48505767-48505789 CCTCCAAGTCTGAAAGGACAAGG - Intergenic
907303142 1:53500605-53500627 CCTCCTGTGCGGAAAGGACACGG + Intergenic
907524272 1:55045052-55045074 CCTCCTGAACTGTAAGCTCAAGG - Intronic
908736903 1:67286013-67286035 CCTCCTGGACTATAAGCTCAAGG + Intergenic
908806120 1:67935117-67935139 CCACATGGACTGAAAGATCAAGG - Intergenic
910044031 1:82890131-82890153 CCTAATGGCCTGAAAGCAAATGG + Intergenic
910468522 1:87525796-87525818 CCTACTGGAATGATAGCCCAAGG + Intergenic
913028227 1:114868677-114868699 CCTCCAGAACAGAAAGCACCAGG - Intronic
913666693 1:121055600-121055622 CCTCCTTGACTGAGAGTTCAAGG + Intergenic
914018380 1:143842724-143842746 CCTCCTTGACTGAGAGTTCAAGG + Intergenic
914320271 1:146552267-146552289 ACCCCTGGACTGGAAGCAAAAGG - Intergenic
914656992 1:149751240-149751262 CCTCCTTGACTGAGAGTTCAAGG + Intergenic
915777642 1:158507853-158507875 CCACGTGAACTGAAAGTACAAGG - Intergenic
916388564 1:164305099-164305121 TCTCATGGACTTAAAGGACAGGG - Intergenic
919791815 1:201296130-201296152 TCTCCTGAACTGAAAGGAGATGG - Intronic
919811451 1:201411413-201411435 CCTGCTGGGCTCCAAGCACAAGG - Exonic
919978031 1:202625602-202625624 CCTCCTGGACGGACAGCAGGGGG - Intronic
920544031 1:206800803-206800825 CCTCCCGGACTTAACACACACGG - Intronic
922099207 1:222468373-222468395 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
922261244 1:223947867-223947889 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
922735828 1:227977873-227977895 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
923043325 1:230335968-230335990 CAACCTGGACTGAAAGTAGAAGG - Intronic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
1066734066 10:38455508-38455530 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG + Intergenic
1075365729 10:121886560-121886582 CCACCTGAACTGAAATCACTGGG + Intronic
1076969142 11:123581-123603 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1077299664 11:1841129-1841151 CCTGCTGGGCTCGAAGCACAAGG + Exonic
1078596041 11:12687791-12687813 CCTGGAGGACTGAAACCACAGGG - Intronic
1080292045 11:30681827-30681849 CATAGTGGCCTGAAAGCACAAGG + Intergenic
1080409345 11:32009144-32009166 CATCTTGGAGAGAAAGCACATGG + Intronic
1081270290 11:41075129-41075151 CATGCTGGAATGAAACCACATGG + Intronic
1081821085 11:45995612-45995634 GCTGCTGGTATGAAAGCACAGGG - Intronic
1082738071 11:56878988-56879010 CCTCCTGGAGTAAAAACTCAAGG - Intergenic
1082834821 11:57644017-57644039 CCTACTGGACAGAAAGCTCCAGG + Intergenic
1083679340 11:64344026-64344048 CCTCCAGCACTGGAAGAACAGGG - Exonic
1084236762 11:67792708-67792730 CCTGCTGCACTGTAAGCCCAGGG + Intergenic
1088101903 11:106165354-106165376 CCTGCTGGACTAACACCACATGG + Intergenic
1088554365 11:111046822-111046844 TCTCCTGATCTGAAAGCCCACGG - Intergenic
1098110889 12:67120590-67120612 TCTCATTGACTGAAAGCACTTGG + Intergenic
1101071494 12:101080600-101080622 ACTCCTGGCCTGAAGACACAGGG - Intronic
1101402048 12:104396985-104397007 CCTCCTGGTCTAAAACTACAGGG - Intergenic
1103718874 12:122962766-122962788 CCACCTGGATTTGAAGCACATGG - Intronic
1106033770 13:26025707-26025729 CCTCCTGGAGTGAATACAAACGG + Exonic
1109181659 13:59221314-59221336 CCTACAGGACTGAAAGCTGAAGG - Intergenic
1109234531 13:59798799-59798821 CCTCCTGGGATGAATGCGCAGGG - Intronic
1110183007 13:72639411-72639433 TATCCTAGACAGAAAGCACATGG + Intergenic
1111389049 13:87567361-87567383 ACTCATAGACTGAAAGCAAAGGG + Intergenic
1112649264 13:101374761-101374783 CCTCCTGGTCTGAAAACACGTGG + Intronic
1115094321 14:29616673-29616695 CTTACTGGACTAAAAGCAAAGGG + Intronic
1122383687 14:101329383-101329405 CCTCCAAAGCTGAAAGCACAAGG + Intergenic
1124085725 15:26548991-26549013 CTTGCTGGAGTGAAAGCCCAGGG - Intronic
1128760000 15:70210144-70210166 CCTGCTGCACTGAAAGCCCTGGG - Intergenic
1129618175 15:77117140-77117162 TCTTCTGGAATGAAAGCTCAAGG + Intronic
1129826633 15:78638776-78638798 CCTGCTGGGCTCAAAGGACAAGG + Intronic
1130103885 15:80914609-80914631 TCTCCTGGACTCAAAGCTCTGGG + Intronic
1131305674 15:91241030-91241052 TCTCCAGGAATGAGAGCACATGG - Intronic
1131674331 15:94655496-94655518 CCTCCAGGACTGTCAGCACTGGG + Intergenic
1131679728 15:94708897-94708919 CTTCCTGGGCTCAAAGCACATGG + Intergenic
1132245819 15:100295415-100295437 CCTACTGAGCTGAAAACACAAGG - Intronic
1132525204 16:410835-410857 CCTCCTGGGATGGAAGCAGACGG - Intronic
1133393473 16:5427798-5427820 CCTGCTGGACTCAAAGTCCACGG + Intergenic
1134366469 16:13583649-13583671 TTTCCTGGATTGTAAGCACATGG - Intergenic
1134367717 16:13594821-13594843 TCTCCTGGACTGAAGGACCACGG + Intergenic
1136280124 16:29203479-29203501 CCTCCAGGACAGAAATCAGAGGG - Intergenic
1136999621 16:35217237-35217259 CTTCCTGGACTGAAAGCCTCAGG - Intergenic
1137003336 16:35250771-35250793 CATCCTGGACTGAAAGCCTCGGG + Intergenic
1138463244 16:57166429-57166451 CATCCTGTCCTGAAAGAACATGG - Intronic
1140013262 16:71157839-71157861 ACCCCTGGACTGGAAGCAAAAGG + Intronic
1140445330 16:75022849-75022871 CCTCCTAGACTCTCAGCACAAGG - Intronic
1141542030 16:84732127-84732149 CCTCCTGGTAAGAATGCACAGGG - Intronic
1142451532 16:90175541-90175563 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1142906153 17:3043574-3043596 TCTCCTGGAATCAAAGGACAGGG + Intergenic
1143550276 17:7626554-7626576 CGTCCTGGACTGGAACCAGAGGG - Exonic
1147015884 17:37490720-37490742 CCTGCTGGATAGAAAGTACAAGG - Intronic
1147982004 17:44280511-44280533 CCTGCTGCCCTGAAAGCAGAGGG - Intergenic
1148134701 17:45284730-45284752 TGTCCTGGACAGAAAGCAGAGGG + Intronic
1148864830 17:50623049-50623071 CCTCCCCCACTGACAGCACAGGG + Intronic
1149029965 17:52071550-52071572 ACTCCGGCACTGAAAGCAGAGGG - Intronic
1151976590 17:77487111-77487133 CCTCCTGTCCAGAAAGCACAAGG + Intronic
1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG + Intergenic
1156361770 18:36390032-36390054 CCTCCTGGATTAGAAGCAGATGG - Intronic
1157289303 18:46398663-46398685 GCTGCTGAACTGAGAGCACACGG + Intronic
1157545954 18:48546652-48546674 CTTCCTGGCCTCAAAGCCCAAGG + Intronic
1157719391 18:49912170-49912192 CCACCTGGAGGGAAAGCAAAGGG + Exonic
1157910598 18:51614341-51614363 CCTCTTAGGATGAAAGCACACGG - Intergenic
1159744216 18:72211183-72211205 TCTACTGGACTGAGAGCACAAGG + Intergenic
1160645948 19:193507-193529 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1160678688 19:403952-403974 CAGCCTGGGCTGAGAGCACAGGG + Intergenic
1160708240 19:539783-539805 CCCCCAGGACTGGAAGCAAAGGG - Intronic
1160989092 19:1853334-1853356 CCTCGTGGACTGGAAGCAGAGGG - Exonic
1163342677 19:16719712-16719734 CCTCCTAGACTGTCAGCAAATGG + Intergenic
1165596460 19:37014230-37014252 CGTCCTGGTCTCAAAGCTCAGGG - Intronic
1166372834 19:42311790-42311812 CCTCCTGGTCTGTGAACACAGGG + Intergenic
1166795500 19:45423259-45423281 CCTCCTGGAGTGGTAGGACAAGG - Exonic
1167768108 19:51497547-51497569 CTTCCCGGACAGAAAGAACAAGG + Intronic
925807932 2:7671022-7671044 CCTCCTAGGTTGAGAGCACAAGG - Intergenic
926312506 2:11684957-11684979 CCACCTGGACTGTAAGCTCCAGG - Intronic
929988261 2:46759519-46759541 CCTCCGTGACTGCAAACACAGGG - Exonic
930033479 2:47071964-47071986 CCTCCTGGGCAGAACTCACAGGG + Intronic
930134475 2:47887387-47887409 CCTCTGGGAATGAAAGAACAGGG + Intronic
930168355 2:48225887-48225909 CCTTCTGGACTACAAGGACAAGG + Intergenic
933311164 2:80662939-80662961 CCTCCTGGCATGAATGTACATGG + Intergenic
933612457 2:84451302-84451324 CCTTCTGGTCTGAAAACATATGG - Intronic
933998302 2:87686072-87686094 CCCCCTGGACTGCAAGCACCTGG + Intergenic
936295546 2:111264801-111264823 CCCCCTGGACTGCAAGCACCTGG - Intergenic
936845765 2:116831001-116831023 CATCCTGGAGTGATAGCCCATGG + Intergenic
937055907 2:118936663-118936685 AATCCTGGACTGAGAGCAAATGG - Intergenic
937255945 2:120555673-120555695 CCTCCTGGAATGCATGCACATGG - Intergenic
937368820 2:121284344-121284366 CCTCCGGGAGCGAGAGCACACGG + Intronic
938661636 2:133492850-133492872 CTTCCTGGACTGGAAGACCAGGG + Intronic
938772691 2:134513813-134513835 CCTCTTGGATTGAAAGTCCAGGG - Intronic
940410495 2:153358064-153358086 CCTGCAGAACTGCAAGCACATGG - Intergenic
945185872 2:207139081-207139103 CCTCGTGGGCTGAAAGCTCAGGG - Intronic
945994798 2:216427053-216427075 CCTTCTGGACTGACAGCAAGGGG - Intronic
947236042 2:227942010-227942032 CTTCCTAGACTGTAAGCACATGG + Intergenic
1169354223 20:4894183-4894205 CCTCCTTGACACAAAGCTCAGGG + Intronic
1170082210 20:12489248-12489270 ACTCCTGGAATGAAAGCAGAGGG - Intergenic
1170725344 20:18921118-18921140 CCTCCAGGCATGAAACCACATGG - Intergenic
1171172823 20:23031001-23031023 GCTCCTGTATTGACAGCACAGGG + Intergenic
1171401204 20:24873917-24873939 CCTCCTGGGGTGAGGGCACATGG - Intergenic
1172810293 20:37642779-37642801 CCTGCTGGACTGGAAGCTCAGGG - Intergenic
1173085822 20:39915965-39915987 CCAGCTGGACTGAAAACACTAGG + Intergenic
1173718780 20:45235489-45235511 TGTCCTGGAATGCAAGCACAAGG + Intergenic
1173744307 20:45424916-45424938 CCTTCTAGACTGTAAGCAAAGGG - Intronic
1175024612 20:55888796-55888818 CCTCCTAGTCTGTAGGCACATGG + Intergenic
1175454816 20:59104525-59104547 ACTCCTGGAATGGAAGCCCACGG - Intergenic
1175969515 20:62677354-62677376 TCTACAGGAGTGAAAGCACAGGG - Intronic
1176279558 20:64292709-64292731 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1178730737 21:35100563-35100585 CCAGATGGACTGAAAGCAAATGG - Intronic
1180220212 21:46353865-46353887 CGTCCTTGACTGGAAGCACGAGG + Intronic
1181359902 22:22326534-22326556 CCTGGTGGACTGTAAGCACTGGG - Intergenic
1181369928 22:22407963-22407985 CCTGGTGGACTGTAAGCACTGGG - Intergenic
1181467271 22:23116960-23116982 CCTGCTGGTCTGAGAGCTCATGG - Intronic
1183309259 22:37100631-37100653 CCTCATGGTCTGAAAGCATAGGG + Intronic
1184114036 22:42411733-42411755 CCTCCTGGAGGGGAAGCAAAGGG + Exonic
1184133005 22:42528982-42529004 TCTCCAGGCCTGAAAGCACCAGG - Intergenic
1184361570 22:44022299-44022321 CCTCCTTTACTGAAAGGAAAAGG + Intronic
950449037 3:13055254-13055276 CTTCCTGGACAGAGAGCCCAGGG + Intronic
951244111 3:20320387-20320409 TCTCCAGGACTCAAAGCACTTGG + Intergenic
952843009 3:37664312-37664334 CCTCCAGGTCAGACAGCACATGG - Intronic
952861531 3:37816763-37816785 CCTCCAGGGCTGAAATCACCAGG + Intronic
953982793 3:47421026-47421048 ACTCCTGGAATCAGAGCACATGG + Exonic
954321946 3:49838288-49838310 CCTGCTGGCCTGAAAGCCAAGGG + Intronic
954437645 3:50504357-50504379 CCTCCAGGACAGAAAGGACTGGG - Intergenic
954438024 3:50506178-50506200 CCTCCAGGACAGAAAGGACTAGG - Intergenic
955139788 3:56257971-56257993 GCTGCCGGTCTGAAAGCACAGGG - Intronic
955292587 3:57706253-57706275 CCTCATGGACTGAGATCACTGGG - Intergenic
958635033 3:96732879-96732901 CTTCCTTGACTGAAATCAAAAGG + Intergenic
959844169 3:111013706-111013728 CCCCCTGGTCTGAATGAACAGGG + Intergenic
961465252 3:127077350-127077372 CCTCCTGGCCTAAAGGCAGAAGG + Intergenic
961867905 3:129967387-129967409 CCTCATGGCCTTTAAGCACATGG + Intergenic
967422892 3:189293364-189293386 CCTCCTGCACTGAAAACTGAGGG + Intronic
967545659 3:190724143-190724165 CCTTCTGGAGTGAAAGCCCAAGG - Intergenic
967841602 3:194009330-194009352 GCTCCTGGAGTCAAAGCTCAGGG + Intergenic
968055890 3:195691383-195691405 CCTCCAGGACTGAAAACGGAAGG - Intergenic
968349675 3:198043465-198043487 CCTCCTGGGCTGCAAGGACATGG - Intronic
968371733 3:198226019-198226041 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
968512763 4:1002772-1002794 CGTCCTGGACAGCAACCACACGG + Exonic
969602627 4:8185946-8185968 CCTCCTGGAGTGGCAGCACTGGG - Intronic
970008115 4:11429188-11429210 CCCCTTGGACTGAAACCCCAGGG - Exonic
970591533 4:17564324-17564346 CCTCCTGGACTGGATGAATAAGG + Intergenic
972205361 4:36765529-36765551 GCTCCTGGACTGAAAACACCAGG - Intergenic
972737767 4:41862197-41862219 CCTTCTAAATTGAAAGCACAGGG + Intergenic
974075811 4:57167231-57167253 CCCCGTGGCCTGAAAGAACATGG + Intergenic
975298789 4:72765929-72765951 CCTGCTGGCCTGCAAGCACCGGG - Intergenic
976874807 4:89839585-89839607 CCTCTTTGACTTAAAGCACTAGG - Intergenic
978103356 4:104871130-104871152 CCTCCTGAACTGAAATCAGCTGG + Intergenic
978715981 4:111842768-111842790 CCTACAGGACTGTAAGTACAAGG - Intergenic
979260421 4:118638497-118638519 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
980631457 4:135440751-135440773 ACTCATAGACTGAAAGCAAAGGG + Intergenic
983971579 4:173882012-173882034 CCTCCTGTACTGATGCCACATGG - Intergenic
984191754 4:176614007-176614029 CCTCCTGGAAAGAAGGCTCAAGG + Intergenic
985678386 5:1243838-1243860 CCTCCTGGATGGAGAGCGCAAGG + Intronic
985902666 5:2808819-2808841 ATTCCTGGACTGGAAGCAAAAGG + Intergenic
986445895 5:7820956-7820978 TCTCCTGTACTGAATGCTCAGGG - Intronic
990986712 5:61647466-61647488 CCTCCTGGACTGCCAAGACAAGG + Intronic
992614230 5:78534179-78534201 CCTCCTGGAGGGACAGCAGAGGG + Intronic
993078712 5:83269331-83269353 CCTCCTTGAGGGAAAGCACCTGG - Intronic
995324689 5:110876502-110876524 ACTTTTGGACTTAAAGCACAAGG - Intergenic
998005254 5:138652523-138652545 CCTCCTGGACTGAAAGCACAGGG - Intronic
998424348 5:142013841-142013863 CCCCCTGAATTGAAGGCACAAGG - Intergenic
998489068 5:142530225-142530247 CTTCTGGGCCTGAAAGCACAAGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999624176 5:153502644-153502666 CCTGCTGTCCAGAAAGCACAGGG + Intronic
1000923989 5:167171571-167171593 CCTCCAGAACTGAAAAAACAAGG + Intergenic
1001676499 5:173522041-173522063 CCTGCAAGACTGAAAACACAGGG - Intergenic
1002730973 5:181331565-181331587 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1002753560 6:142539-142561 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1003765462 6:9231465-9231487 CCTCCTGGATCCAAACCACATGG + Intergenic
1006979529 6:38135865-38135887 CCTTCTGGACTGCAGGCTCAAGG - Intronic
1007065577 6:38987431-38987453 CTTCCTGATCTAAAAGCACAGGG + Intronic
1007978713 6:46128775-46128797 CCTCCAGCTCTGAAAGCCCATGG + Intergenic
1008266569 6:49434971-49434993 CATCCTGGAGGAAAAGCACAAGG + Intronic
1010587794 6:77675773-77675795 CTTCCTGTACAGAAAGCTCATGG + Intergenic
1014681561 6:124437124-124437146 CCACCTGGACTGACAGTGCAAGG - Intronic
1014791193 6:125674336-125674358 CCTCTCACACTGAAAGCACAGGG + Intergenic
1015868558 6:137752560-137752582 TCTCCTGGCCTGAAAGTGCAAGG - Intergenic
1017061145 6:150486188-150486210 CCTCCTTGACAGAAAGCAGAAGG + Intergenic
1017260520 6:152381041-152381063 CCTCCTGGAAGGCAAGAACACGG - Exonic
1017915171 6:158825989-158826011 TCTGCTGGACTGGAGGCACAGGG - Intergenic
1019410437 7:904417-904439 CCTCCCGGTCTGTAAGCAGAAGG + Intronic
1023008138 7:35897342-35897364 GCTCCTGGGCTGAAAGCACTAGG + Intronic
1023015456 7:35965180-35965202 GCTCCTGGGCTGAAAGCACTAGG + Intergenic
1023402138 7:39798097-39798119 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1024065483 7:45729496-45729518 GCTCCTGGGCTGAAAGCATTAGG - Intergenic
1024076119 7:45818727-45818749 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1024647485 7:51382563-51382585 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025051319 7:55737058-55737080 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025060085 7:55798313-55798335 CCACCTGCCCTGAAAGCCCAGGG + Intronic
1025128284 7:56362725-56362747 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025176666 7:56805606-56805628 CCACCTGCCCTGAAAGCCCAGGG + Intergenic
1025695126 7:63770780-63770802 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1027535498 7:79394832-79394854 CCTTCTAGAATGAAAGCAAATGG + Intronic
1028582470 7:92422106-92422128 CCTCCAGGACTGAGAGAGCAGGG + Intergenic
1029203342 7:98853714-98853736 CCTCATGGACAGAATGCACTCGG + Intronic
1032052651 7:128658490-128658512 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1032303301 7:130709592-130709614 TCTCCTGATCTCAAAGCACAGGG + Intergenic
1034237968 7:149587366-149587388 TCCCATGGACTGAAAACACAGGG - Intergenic
1036595663 8:10209747-10209769 CCTTCAGGACTGAAAGCTCTTGG + Intronic
1039167848 8:34706307-34706329 CCTCATGCACTGTAAGCAGAAGG - Intergenic
1041888874 8:62846167-62846189 TTTACTGGACTGAAAACACATGG - Intronic
1047333965 8:123918934-123918956 CCTGCTGGACTGAGAGCCCTTGG - Intronic
1048194666 8:132322473-132322495 CCTCCTGAGCTGTAAGGACATGG + Intronic
1048243326 8:132766136-132766158 CCTCCAGGAATGATGGCACAAGG - Intergenic
1048377530 8:133835612-133835634 TCTGCAGGACTGAAAGCACACGG + Intergenic
1048422681 8:134292852-134292874 CCTCCTGGAATGGAGGCACTTGG - Intergenic
1049003068 8:139838338-139838360 CCTGCTGGACTGCAAGCTCTGGG + Intronic
1049844906 8:144795572-144795594 CCTGAGGCACTGAAAGCACATGG - Intergenic
1052438698 9:28465191-28465213 CCTCTTGGAATGAGAGGACAAGG - Intronic
1055486106 9:76758358-76758380 CCTCCTGGACTGAAAATACTAGG - Intronic
1055652807 9:78423316-78423338 CCTTCTGGTGTGAAAGCAAAGGG + Intergenic
1056936586 9:90919454-90919476 CTTCCTGGGCAGAAAGCACATGG - Intergenic
1057125469 9:92612810-92612832 CCTCCCAGGCTGAATGCACAGGG + Intronic
1057561384 9:96130610-96130632 CATCCTGGACTTAAAGATCAAGG - Intergenic
1058410343 9:104724702-104724724 CCTCCTGGTCAGAACGCAGAGGG + Intergenic
1058523838 9:105837889-105837911 GCTCCTGCCCTGAAATCACAGGG - Intergenic
1059564210 9:115366710-115366732 CCTCTTGGACTGTGAGTACAAGG + Intronic
1060382637 9:123191045-123191067 TCTTCTGGACTTAAACCACAAGG - Intronic
1062225713 9:135448779-135448801 CCTCCGTGACTGCAAACACAGGG - Intergenic
1062755379 9:138284072-138284094 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1203579292 Un_KI270745v1:28244-28266 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1186824818 X:13328982-13329004 TCTCCTGGACTGAAAACAACAGG - Intergenic
1189076509 X:37921046-37921068 CCTCATGCACAGAAAGCACAAGG - Intronic
1190055393 X:47178487-47178509 CCTCATGGCCTAATAGCACAGGG - Intronic
1196001050 X:110786502-110786524 CCTTCTGGACTGAAAACTAAAGG - Intronic
1198069343 X:133132491-133132513 TCACCTGGAGTTAAAGCACATGG + Intergenic
1198733496 X:139760133-139760155 CCTCCTGGATGGAAAGCCAAAGG + Intronic
1201590027 Y:15604472-15604494 CCTGCAGGACTGACACCACATGG + Intergenic
1202381899 Y:24280866-24280888 CCACCTGCCCTGAAAGCCCAGGG - Intergenic
1202488885 Y:25389259-25389281 CCACCTGCCCTGAAAGCCCAGGG + Intergenic