ID: 998007225

View in Genome Browser
Species Human (GRCh38)
Location 5:138665132-138665154
Sequence CCTCAGCTGCCCCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998007225_998007236 14 Left 998007225 5:138665132-138665154 CCCATCCTTGGGGGCAGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 257
Right 998007236 5:138665169-138665191 CTCAGCTGAAGGCCTTTCTTGGG 0: 1
1: 0
2: 2
3: 17
4: 201
998007225_998007235 13 Left 998007225 5:138665132-138665154 CCCATCCTTGGGGGCAGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 257
Right 998007235 5:138665168-138665190 CCTCAGCTGAAGGCCTTTCTTGG 0: 1
1: 0
2: 1
3: 25
4: 253
998007225_998007237 18 Left 998007225 5:138665132-138665154 CCCATCCTTGGGGGCAGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 257
Right 998007237 5:138665173-138665195 GCTGAAGGCCTTTCTTGGGTTGG 0: 1
1: 0
2: 0
3: 18
4: 135
998007225_998007232 3 Left 998007225 5:138665132-138665154 CCCATCCTTGGGGGCAGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 257
Right 998007232 5:138665158-138665180 CAGGGCCTCTCCTCAGCTGAAGG 0: 1
1: 0
2: 4
3: 39
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998007225 Original CRISPR CCTCAGCTGCCCCCAAGGAT GGG (reversed) Intronic
900015978 1:150265-150287 CCTCAGCTGCCCCCATACCTGGG + Intergenic
900046241 1:508862-508884 CCTCAGCTGCCCCCATACCTGGG + Intergenic
900068443 1:750574-750596 CCTCAGCTGCCCCCATACCTGGG + Intergenic
900151257 1:1180232-1180254 CCTCAGCTGCCCTCCTGGAGGGG + Exonic
900560759 1:3304909-3304931 CCTCCGCTGCCACCCAGGACTGG + Intronic
900988404 1:6086465-6086487 CCTCCTCTGCCCCGAAGCATCGG - Intronic
901165634 1:7219783-7219805 CCTCAGCTGCCCAAAATGCTGGG - Intronic
902981363 1:20125816-20125838 TCTCAGCTGTCACCAAGGCTGGG - Intergenic
903672590 1:25045526-25045548 CCTCTGCCCCCCTCAAGGATGGG + Intergenic
904029317 1:27524040-27524062 ACCCAGCTGCCCCCAGGGTTTGG - Intergenic
904286880 1:29458757-29458779 CCCCAGTTGGCCCCCAGGATGGG + Intergenic
904408919 1:30313140-30313162 GCTCAGCAGCCCCCAGTGATAGG - Intergenic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905463119 1:38134137-38134159 GCTCCCCTGCCCCCATGGATGGG + Intergenic
906219821 1:44069723-44069745 CCTCAGCATCCCCCAAAGTTAGG - Intergenic
906509836 1:46404721-46404743 CCTCAGGTGCCCCCCAGGTAGGG - Intronic
908372271 1:63495055-63495077 CCTCAGCCTCCCCCAAAGCTGGG + Intronic
910187558 1:84559967-84559989 CCTCAGCTTCCCCCATAGGTGGG - Intronic
912369744 1:109164764-109164786 CCTCCGCTGCCCCTCAGGCTGGG + Intronic
913679987 1:121180607-121180629 CCTCAGCTTCCCAAAAGGCTGGG - Intronic
914031822 1:143968257-143968279 CCTCAGCTTCCCAAAAGGCTGGG - Intronic
914157623 1:145099710-145099732 CCTCAGCTTCCCAAAAGGCTGGG + Intronic
915011098 1:152686991-152687013 CCACAGCAGCCCCCAGAGATGGG - Exonic
915150613 1:153827980-153828002 GTTCAGCTGCCTCCAGGGATAGG - Intronic
915647748 1:157285983-157286005 CCTCTGCTGACCCCATGGGTTGG + Intergenic
917575564 1:176317768-176317790 CCCCAACTGCCCCCAAGTATTGG - Intergenic
918056504 1:181026098-181026120 CCTCCACTGCCCACAAGGAAAGG + Intergenic
918345301 1:183602578-183602600 CCTTAGATGGCCCCAAGGGTGGG - Intergenic
920118171 1:203636025-203636047 CCTCAGCTGGCCCCATGGCATGG - Intronic
920467299 1:206199140-206199162 CCTCAGCTTCCCAAAAGGCTGGG - Intronic
920982382 1:210850246-210850268 CCTCAGCCTCCCAAAAGGATGGG - Intronic
922103803 1:222495960-222495982 CCTCAGCTGCCCCCATACCTGGG + Intergenic
922264121 1:223968477-223968499 CCTCAGCTGCCCCCATACCTGGG + Intergenic
922350627 1:224732243-224732265 CCTCACCTGCACCCAATTATGGG - Intronic
924235447 1:241996199-241996221 AGTCAGCAGCCCCCAGGGATGGG - Exonic
1063173025 10:3526621-3526643 CCCCAGATTACCCCAAGGATGGG + Intergenic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1063542997 10:6953601-6953623 CCTCAGCTGCCTCCAAACACTGG - Intergenic
1063648222 10:7907342-7907364 TCTCATCTGCCAGCAAGGATAGG - Intronic
1064221869 10:13447968-13447990 CCTAAGCTGCCCCCCAGGAGTGG - Intronic
1064672527 10:17731340-17731362 GCTCAGCTGCCTCTAAGGATGGG - Intergenic
1065320596 10:24505555-24505577 CCTCAGCCACCCACAAGGAGGGG - Intronic
1066730374 10:38431346-38431368 CCTCAGCTGCCCCCATACCTGGG - Intergenic
1067756714 10:49011206-49011228 CCTCAGCTGTCCTCCAGGGTTGG + Intergenic
1068945461 10:62724696-62724718 CATCAGCTGCCCCCAGTGGTTGG - Intergenic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070335917 10:75455092-75455114 GCTCAGGTGCCTCCAAGGAGGGG - Intronic
1070813301 10:79309111-79309133 CCCCAGCTGAGCCCAAGGCTGGG + Intronic
1071526485 10:86362640-86362662 CCTCTGCTGCACCCAAGAATAGG + Intronic
1071867819 10:89755842-89755864 CCTCAGCTTCCCCCAAGTGTTGG + Intronic
1073774122 10:106767092-106767114 CATCAGCTCCCCACAAGTATTGG - Intronic
1076115291 10:127891476-127891498 CCTCAGCTTCCCATAAGGATGGG - Intronic
1076338987 10:129729555-129729577 CCTCAGCTGCCCCGAGGCAGGGG + Intronic
1076720250 10:132389293-132389315 GCCCAGCTGCCCCCAAGGCCTGG - Intergenic
1076972569 11:145334-145356 CCTCAGCTGCCCCCATACCTGGG + Intergenic
1077549994 11:3195922-3195944 CATGAGCTGTCCCCAAGGCTAGG + Intergenic
1078760219 11:14245613-14245635 CCTCAGCTCCACCCAAGCCTGGG - Intronic
1079185262 11:18230804-18230826 CCTCAGCTTCCCAAAAGGCTAGG + Intronic
1079831418 11:25274213-25274235 CCTCAGCTGCCCAAAATGCTGGG + Intergenic
1080909464 11:36581222-36581244 CCACAGCTGCTCTCAAGGGTTGG + Intronic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1083832738 11:65243312-65243334 CCTCAGCTTCCCCAAATGCTGGG + Intergenic
1084162576 11:67357831-67357853 CCTCATGTCCCCACAAGGATCGG - Intronic
1084324482 11:68391718-68391740 CCTCAGCGGCCCGCAAACATGGG - Intronic
1084534527 11:69748809-69748831 CGTCAGCTGCACCCCAGCATGGG + Intergenic
1084672607 11:70616109-70616131 CCTCAGCTGCTCATCAGGATGGG + Intronic
1085266059 11:75238780-75238802 CCCCTGCTGCCCCCCAGGAAAGG - Intergenic
1085308844 11:75504111-75504133 GCTCAGCTGCCCTCATGGATGGG + Intronic
1086409875 11:86534422-86534444 CCTCAGCTTCCCACAATGCTGGG - Intronic
1087640980 11:100753428-100753450 CCTCATCTGCCCACAAAGCTGGG + Intronic
1088727079 11:112648771-112648793 CCTCTGCTTCCCCCACGGAAAGG + Intergenic
1090346235 11:126073565-126073587 CCTCAGCTCCCCCAAAGAGTTGG - Intergenic
1093109703 12:15134859-15134881 CCTCAGCTGCCCAAAATGCTGGG + Intronic
1096725315 12:53556724-53556746 CCCCAGCTGTGGCCAAGGATAGG - Intronic
1097309160 12:58099912-58099934 CCTCAGCTTCCCCAAATGCTGGG - Intergenic
1098003709 12:65972304-65972326 CCTCCCCTGCCACCAGGGATTGG - Intergenic
1099478629 12:83140094-83140116 CCACACCTGCCCCCAAGCAGAGG - Intergenic
1102260028 12:111437918-111437940 CCTCAGCTGGCAGCAAGGTTTGG + Intronic
1103080326 12:118018724-118018746 CCCCAGCTACCCCGAAGGCTGGG - Intronic
1103421067 12:120783169-120783191 CATCAGCTGCCACCAATGACTGG + Intronic
1104392864 12:128405907-128405929 TCTCAGCAGCCCCCATGGACAGG + Intronic
1104408420 12:128538044-128538066 CCTCAGCTTCCCCCATAGCTGGG + Intronic
1106701744 13:32236098-32236120 CCACAGCCGCCTCCAAGGTTAGG - Exonic
1108716672 13:53086081-53086103 TCTCAGCTTCACCCAAGGCTAGG - Intergenic
1112478075 13:99750198-99750220 CCTCAGCCCCCTCAAAGGATTGG + Intronic
1113442568 13:110340629-110340651 CCGCAGCTGCCCCAAAAGACTGG - Intronic
1113455174 13:110443677-110443699 CCTCAGCTTTCCCTAAGGGTGGG + Intronic
1114088878 14:19267272-19267294 CCTCAGGGGCCGCCGAGGATGGG + Intergenic
1114203126 14:20541644-20541666 CCTCAGCTGCCCCAAATGCTGGG + Intergenic
1115666476 14:35554679-35554701 CCAAATCTGCCCCCAAGAATCGG - Intronic
1117105785 14:52395781-52395803 ACCCACCTACCCCCAAGGATGGG + Intergenic
1118748811 14:68792398-68792420 CCCCAGCTCCCCCCAAAGAGTGG + Intronic
1118840155 14:69503746-69503768 CCTCAGCTGCCCGAAAAGCTGGG - Intronic
1119760020 14:77143689-77143711 CCTCAGCTCCCCTTAAGGAATGG + Intronic
1120209456 14:81620679-81620701 CCTCAGCTTCCCACACTGATGGG - Intergenic
1121121047 14:91376145-91376167 CCGCTGCTGCCCCCCAGGACAGG + Intronic
1121416970 14:93786473-93786495 CATGAGCTGCCCCAAATGATGGG - Intronic
1121561426 14:94878914-94878936 TCTCAGCTGCCTTCATGGATAGG - Intergenic
1122078938 14:99253760-99253782 TCTCAGCTCCCCCAAAGGATGGG + Intronic
1124250078 15:28101319-28101341 CCTCAGCTGCCGCCAGGGCTGGG - Intergenic
1127670098 15:61186947-61186969 TCTCAGCTGCCTCCAAGATTGGG - Intronic
1128161827 15:65427927-65427949 CCTCAGCAGCCCCCAAGCAGTGG + Intergenic
1129001753 15:72341396-72341418 CCTCAGCTCCTACCAAGGAGAGG + Exonic
1131268624 15:90933390-90933412 CCTCAGCTGCCCCTAAGGCAGGG - Intronic
1131431028 15:92389191-92389213 CCTCAGATGCCTACAAGGAAGGG + Intergenic
1132378071 15:101345080-101345102 CCTCAGGGGCACCCAAGGAAAGG - Intronic
1132542779 16:519072-519094 CCTCAGCTGCCCCACAGGCAGGG - Intronic
1132605153 16:790552-790574 CCTCAGGGGCCCCCAAGGGCTGG - Exonic
1132689516 16:1176336-1176358 TCACAGCTGGACCCAAGGATGGG - Intronic
1132760642 16:1507115-1507137 CCTCACCTGCGCCCAGGGATGGG + Intronic
1134264508 16:12681747-12681769 CCTCAGCTGCCTCCAGGTGTTGG - Intronic
1134451323 16:14365482-14365504 CCTCAGCTGCCCAAAATGTTGGG - Intergenic
1134451566 16:14367199-14367221 CCTCAGCTGCCCAGAATGTTGGG + Intergenic
1134803040 16:17103229-17103251 CCTCCCCTGCCCCCAAGACTGGG - Exonic
1134843823 16:17423333-17423355 ACTCAGCTGCCCCTGAGGAGTGG - Intronic
1135661754 16:24303042-24303064 CCTCAGCTTCCCAAAAGGTTGGG + Intronic
1137068156 16:35872737-35872759 TCTCAGCCTCCCCAAAGGATGGG + Intergenic
1137263250 16:46847998-46848020 CCTGAGCTTCCCCCAGAGATTGG + Intergenic
1137674877 16:50299299-50299321 GCTCCGCTCCCCTCAAGGATGGG + Intronic
1138442236 16:57042025-57042047 GCTCAGCTGCTCCCAGGGCTGGG + Exonic
1140349469 16:74248333-74248355 ACTCATCTGGCCCCAAGGATCGG + Intergenic
1141356328 16:83350064-83350086 TCAAAGCTGTCCCCAAGGATGGG + Intronic
1141719863 16:85750312-85750334 CCGCAGCTCCCCCCAGGGATAGG - Intronic
1142010499 16:87711520-87711542 CCCCAGGTGCCCCCCAGAATGGG + Intronic
1142447681 16:90152187-90152209 CCTCAGCTGCCCCCATACCTGGG - Intergenic
1142459809 17:83136-83158 CCTCAGCTGCCCCCATACCTGGG + Intergenic
1143099056 17:4495015-4495037 CCTCAGCTTCCCAAAAGGCTGGG - Intergenic
1145075173 17:19847796-19847818 CCTCAGCTGCCCACAGTGCTGGG + Intronic
1146372800 17:32275791-32275813 CCTCAGCTGCCACCATAGAGGGG - Intronic
1146647743 17:34586403-34586425 CTCCAGCAGTCCCCAAGGATGGG + Intronic
1147922924 17:43929515-43929537 CCTCAGCTTCCCACAATGCTGGG + Intergenic
1148474200 17:47916382-47916404 CACCAGCTGCCCTCCAGGATAGG - Exonic
1148547383 17:48528691-48528713 CCTGGGCTGCCCCCAGGGGTAGG + Exonic
1150259192 17:63774409-63774431 CCTCCAGTGCCCCCAAGGACTGG - Intronic
1150458439 17:65327146-65327168 CAGCAACTGCCCACAAGGATGGG + Intergenic
1150870885 17:68910266-68910288 ACACAGCTGCTGCCAAGGATGGG - Intronic
1151376887 17:73695346-73695368 CCTCAGCTGGCACCAGGGACTGG - Intergenic
1151815886 17:76471203-76471225 CCTCAGTTGCCCCCAGGGCTGGG - Exonic
1152636710 17:81433157-81433179 CCTCAGGGGGCCCCAAGGATTGG + Intronic
1152888811 17:82868182-82868204 CCTGAGCTGCACCCAAGGAGAGG + Intronic
1154284156 18:13036028-13036050 CCTCAGCTTCCCCAAAAGCTGGG - Intronic
1154340076 18:13495615-13495637 CCTCAGCTGCCTTGAAGAATTGG + Intronic
1155333571 18:24742297-24742319 CCTCCAGTGCCCCCAAGGAGTGG - Intergenic
1155365124 18:25042075-25042097 CCTCAGCTTCCCCAATAGATGGG + Intergenic
1157213279 18:45761837-45761859 CCTCAGAGGACCCCATGGATGGG - Intergenic
1157369386 18:47096571-47096593 CCTCAGCTTCCCCAAGGGCTGGG + Intronic
1157434771 18:47659052-47659074 CCTCAGGTGCCCTCACAGATAGG - Intergenic
1160649525 19:215644-215666 CCTCAGCTGCCCCCATACCTGGG + Intergenic
1160685757 19:435956-435978 CCCCGCCTGCCCCCCAGGATTGG - Intronic
1160869410 19:1270190-1270212 CCTGAGGTGCCCCCCAGGACGGG + Intronic
1161175796 19:2841637-2841659 CCTCAGCTCCCCCCAAGCCGCGG - Intronic
1163138468 19:15331297-15331319 GCTGAGATGCCCCCAAGGCTTGG - Intronic
1164479432 19:28600026-28600048 CCTTAACTGGCCCCAAGGATGGG + Intergenic
1166370050 19:42295360-42295382 CCTCAGCTGCCCCCCAGCACCGG - Exonic
1166521450 19:43482994-43483016 CATCAGCTTCCCCCAAAGGTGGG + Intronic
1166702764 19:44891609-44891631 CCTCAGGGGCCGCCGAGGATGGG + Exonic
1167740234 19:51320281-51320303 CATCAGCAGCCCCACAGGATGGG - Intronic
925035998 2:686313-686335 CCACAGCTGCTCTCAAGGACTGG - Intergenic
926204301 2:10824293-10824315 TGTAAGCTGCCCCCAGGGATGGG - Intronic
928582077 2:32718995-32719017 CCTCCTCTGCCCCCTAGGCTTGG - Intronic
929246155 2:39705891-39705913 CATCTGCTGCCCCCAAGGCCAGG - Intronic
929463507 2:42123865-42123887 GCTCAGCTGCCTCCAGGGAGAGG + Intergenic
930358202 2:50346808-50346830 CCTCAGCGGCCTCCTAGGAGTGG - Intronic
933707002 2:85298817-85298839 CCTCAGCTGCCCCCAGGGGCAGG - Intronic
933847679 2:86338337-86338359 CCGGAGCAGCCCCCAAGGAAAGG - Intergenic
936386079 2:112030577-112030599 GCTCAGCTGCCCCGAAGGCTGGG - Intergenic
938308317 2:130269002-130269024 CCTCAGTTGTCCCCAAGGTCAGG - Intergenic
938447012 2:131387834-131387856 CCTCAGTTGTCCCCAAGGTCAGG + Intergenic
938487314 2:131724064-131724086 CCTCAGGGGCCGCCGAGGATGGG - Intronic
941101484 2:161300794-161300816 CCTCAGCCGCCCAAAAGGCTAGG - Intergenic
943754606 2:191544983-191545005 CCTCAGCAGGCCCAAAGGACTGG - Intergenic
946706670 2:222465083-222465105 CCTCTGCTGCGTCCAAGGATAGG - Intronic
947378402 2:229521031-229521053 CCTCTGCTTCCGCCAAGGCTGGG - Intronic
947445724 2:230161233-230161255 ACTCAGCTGCCCCCATGACTTGG - Intergenic
947639679 2:231700065-231700087 TCTCAGCTGCCTCCAAGGTAAGG - Intergenic
947668171 2:231919967-231919989 CCACAGGTGTCCCCAAGGAAGGG + Intergenic
948270064 2:236667374-236667396 CCTCGGCTTACCCCAAGGATGGG + Intergenic
948807903 2:240460855-240460877 CCTCAGCTGCCCCGGAGGCTGGG - Intronic
949008956 2:241667776-241667798 TCTCAGCTGCCCCCACACATAGG + Intronic
1168997790 20:2145774-2145796 AGACAGCTGCCCCCAAGGAAAGG - Exonic
1171200780 20:23240361-23240383 CCTCAGCTGCCCCAAGAGCTGGG + Intergenic
1171456970 20:25277618-25277640 CTCCAGCTGGCCCCAAGGAGCGG - Intronic
1174333978 20:49844531-49844553 CCTCAGCTTCCCCAAATGCTGGG - Intronic
1175582441 20:60111049-60111071 CCTCAGCTGCCCCCAGGGTTGGG + Intergenic
1175919476 20:62443727-62443749 CCTCAGCCTCCCCAAAGTATTGG + Intergenic
1176728390 21:10464187-10464209 ACTCTTCTGCCCCCAAAGATTGG - Intergenic
1179233243 21:39524153-39524175 CCCCATCTGCCCACAAGGCTGGG + Intergenic
1179450790 21:41467005-41467027 CCTGGGCAGCCCCCAAGGTTAGG - Intronic
1179682239 21:43031318-43031340 CCTCGGCAGCCCCCACGGGTTGG + Exonic
1180491828 22:15855064-15855086 CCTCAGGGGCCGCCGAGGATGGG - Intergenic
1181478084 22:23180798-23180820 CCTCACCTGCCACCAGGGAGTGG + Exonic
1183049503 22:35249307-35249329 CCTCAGCCTCCCCCAAGTACTGG + Intergenic
1184441697 22:44520899-44520921 CCTAAGATGCCCCCAAGCATGGG - Intergenic
950743202 3:15065822-15065844 CCTCGGCTTCCCCAAAGGCTGGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954255109 3:49399686-49399708 CCTCAGCTGCCCCAAGTGCTGGG + Intronic
956182898 3:66533855-66533877 CCTCAGCTGCCCAGAGGGCTGGG + Intergenic
956684979 3:71817930-71817952 CCTCAGCTTCCCCCAGTGCTGGG - Intergenic
961432909 3:126895895-126895917 CCTCTGCTGCACCGAAGGACAGG + Intronic
961983225 3:131103896-131103918 CCTCTGCTGCCCCCAAGGTGGGG - Intronic
962351623 3:134660514-134660536 CATTATTTGCCCCCAAGGATAGG + Intronic
963315192 3:143751544-143751566 CCCCAGCTGACCCCAAGGAGTGG - Intronic
964829206 3:160864425-160864447 CCTCAGCTTCCCCAAATGCTGGG + Intronic
967133574 3:186494524-186494546 CCTCAGCTGCCCACATAGCTGGG - Intergenic
968353393 3:198080932-198080954 CCTCCGCAGCCACCAGGGATGGG + Intergenic
968368322 3:198204487-198204509 CCTCAGCTGCCCCCATACCTGGG - Intergenic
969366816 4:6700217-6700239 CCTCAGCTTCCCCAAATGCTGGG + Intergenic
969376965 4:6769301-6769323 CCGCAGCTGCACCCAGGTATGGG - Intergenic
969610643 4:8225934-8225956 CTCCAGCTGCCCCCAAGGCCAGG + Intronic
971121928 4:23714166-23714188 CCTCAGCTTCCACCCAGGCTGGG - Intergenic
974938260 4:68433347-68433369 CCTCAGCTGCCCGAATAGATGGG - Intergenic
977394052 4:96450184-96450206 CCTCTGCTGCCTCCAAGTTTGGG - Intergenic
978462851 4:108976666-108976688 CCTCCACTGGCCCCTAGGATGGG - Intronic
986573386 5:9188589-9188611 CCTCAACTGCCTCCTAGAATTGG + Intronic
986995297 5:13601005-13601027 ACTCAGCTGCTCCCAGGAATTGG + Intergenic
989219067 5:38934753-38934775 CCTCAGCTTCCCCAAGGGCTGGG + Exonic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
994028089 5:95108210-95108232 CCTTAGCTGCCCTAAAGGAAAGG + Intronic
996188468 5:120509391-120509413 TCTCAGTAGCCCCAAAGGATTGG - Intronic
997062972 5:130529200-130529222 CCCCAGCTGCCACCATGCATAGG - Intergenic
998007225 5:138665132-138665154 CCTCAGCTGCCCCCAAGGATGGG - Intronic
998387139 5:141763910-141763932 GCTCAGCTGCCCCCACTGTTGGG - Intergenic
999229399 5:150052744-150052766 CCTCAGCTTCCCCCAAATGTGGG - Exonic
999478888 5:151926457-151926479 GCTCAGCTCCCTCCAAGGCTAGG + Intergenic
1000160071 5:158588753-158588775 CCTAAGCACCCCCCAAGCATGGG + Intergenic
1002277971 5:178115374-178115396 CTGCAGCTGCCCCTAAGGAATGG - Intronic
1002727543 5:181309714-181309736 CCTCAGCTGCCCCCATACCTGGG - Intergenic
1003047109 6:2744033-2744055 CCACAGCTGCTCCCAAAGAATGG - Intronic
1004634647 6:17455108-17455130 TCTCAGCTGGCACCAAGGAACGG + Intronic
1006923431 6:37640863-37640885 CCTCACCAGCCCCAAAGGAACGG - Intronic
1007341086 6:41191983-41192005 CTTCAGCTTCCCCTAAGGTTAGG - Exonic
1008610098 6:53177759-53177781 CCTCAGCTGCCCAAAGGGCTGGG + Intergenic
1010807376 6:80254078-80254100 CCTCAGGTGTCATCAAGGATGGG + Intronic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1014887856 6:126803560-126803582 CCCCAGCTGTTGCCAAGGATGGG - Intergenic
1015290631 6:131534927-131534949 CCTCAGTTGCCTCCCAGGAAGGG - Intergenic
1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG + Intronic
1021895157 7:25226770-25226792 CCTAACCTGCCCCAAAGGTTTGG - Exonic
1023202792 7:37717086-37717108 CCTCAGATGCACCCATGGTTTGG - Intronic
1023886310 7:44359824-44359846 CCTCTGCTGCCTCCAAGGTGGGG - Intergenic
1024236148 7:47400741-47400763 CCGCAGCTGCCCACAAGCACAGG + Intronic
1024518468 7:50282296-50282318 CCTCTGAAGTCCCCAAGGATAGG + Intergenic
1026113201 7:67474798-67474820 CTTCAGCTGCCCACCAGGATAGG + Intergenic
1026147930 7:67763990-67764012 CCTCAGCTCCCCCTGAGGTTGGG + Intergenic
1026596793 7:71739652-71739674 CCTCACCTGCCCCCAGGGGCCGG + Intergenic
1028817670 7:95165895-95165917 CCTCAGCTTCCCAAAATGATGGG - Intronic
1029252726 7:99248633-99248655 CCTCAGCTTCCCCAAATGCTGGG + Intergenic
1029515543 7:101020930-101020952 CCTCACCTGCCCCCAGAGAAGGG + Intronic
1031048001 7:116915025-116915047 CCTCAGCTTCCCGAAATGATAGG - Intronic
1032085327 7:128880661-128880683 CCTCTCCTGCCCCCATGGCTGGG - Exonic
1032855793 7:135832570-135832592 CCTCTGCAGGCACCAAGGATCGG + Intergenic
1034601704 7:152263786-152263808 ACTCTTCTGCCCCCAAAGATTGG + Intronic
1035535244 8:386126-386148 CCTGAGCTGCCCCCAGGGGCAGG + Intergenic
1035818090 8:2562216-2562238 CCTCACCTGCCTCCAGGGACCGG + Intergenic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1040839633 8:51771540-51771562 CCTTACTTGCCCCCAAGGATAGG - Intronic
1042564227 8:70096645-70096667 CCTCAGCTTCCCCAAATGCTGGG + Intergenic
1044931995 8:97260040-97260062 GCTCAGCTGGCCCCATGGCTAGG - Intergenic
1048305288 8:133279750-133279772 CCTCAGCTGTGTCCAAGAATAGG - Intronic
1048991838 8:139765125-139765147 CCACAGATGCACCCAAGGGTGGG + Intronic
1049357276 8:142195141-142195163 CCCCAGCTGTCCCCAAGGGCAGG + Intergenic
1049710772 8:144062389-144062411 CCTCAGCTGGGCCTCAGGATGGG - Intronic
1049753785 8:144298715-144298737 CCTCAGCTGCCCCAAAGTCTGGG - Intronic
1050227741 9:3479880-3479902 CCTCAGATTCACCCAAGTATAGG + Intronic
1050364986 9:4865679-4865701 CCTCAGCTGCCCAAAATGTTAGG + Intronic
1052491334 9:29173141-29173163 CCACAGCTGCACCCAAAGGTTGG - Intergenic
1052744241 9:32424238-32424260 GATGAGCTGCCTCCAAGGATGGG + Intronic
1052877821 9:33580576-33580598 CCGCAGCTGCCCTCATGGATGGG - Intergenic
1052880012 9:33596029-33596051 CCACAGCTGCCCCCATGGGCTGG - Intergenic
1053495960 9:38548191-38548213 CCACAGCTGCCCCCATGGACTGG + Intronic
1053498162 9:38563629-38563651 CCGCAGCTGCCCTCATGGACGGG + Intronic
1055296426 9:74837998-74838020 CCTCAGCTTCCCGAAAGGCTGGG + Intronic
1056733697 9:89186252-89186274 CCTCAGCCAGCTCCAAGGATGGG + Intergenic
1058778500 9:108309720-108309742 CTGCAGCTGCCCCCAGGGAGTGG + Intergenic
1060220844 9:121763338-121763360 CCCCAGCAGCCCCCAAAGGTGGG + Intronic
1060522514 9:124301661-124301683 CATCAGCAGCCCCCAAGGCCAGG - Intronic
1060925475 9:127452352-127452374 CCCCACCTGCCTGCAAGGATGGG - Intronic
1061844864 9:133381797-133381819 CCTCATATGCCCCCTAGGACAGG + Intronic
1062024929 9:134335892-134335914 CCTAAGCTGCCCACAGGGAGAGG - Intronic
1062201061 9:135302920-135302942 CCTCAGCTGTCCCCAGGGAAAGG + Intergenic
1062341656 9:136096108-136096130 CCTCAGCTGCCCCCTAACCTGGG + Intergenic
1062752662 9:138267192-138267214 CCTCAGCTGCCCCCATACCTGGG - Intergenic
1203575180 Un_KI270745v1:1967-1989 CCTCAGCTGCCCCCATACCTGGG - Intergenic
1188370934 X:29368851-29368873 GCTCAGCTACCTCCAAGGAGTGG - Intronic
1190359806 X:49638166-49638188 CTCCATCTGCCACCAAGGATGGG + Intergenic
1192196598 X:69032916-69032938 GCTCAACTTCCCCCAAGGAAGGG + Intergenic
1192868388 X:75160777-75160799 CCTCAGCTTCCCCAATGGCTGGG + Intergenic
1193045984 X:77055004-77055026 CTGCAGCTGCCCCCTAAGATAGG + Intergenic
1194211976 X:91081516-91081538 CCATGGCTGCCCTCAAGGATTGG + Intergenic
1194749649 X:97670295-97670317 CCCGAGCTGCCCACAAGGCTTGG + Intergenic
1194900037 X:99498326-99498348 CCTCTGCTGCCCCCAAGCTGTGG + Intergenic
1196138238 X:112232865-112232887 CCTCAGCTCCCCTCAAGAAGTGG - Intergenic
1197764542 X:130051349-130051371 CTCCAGCTTCCCCCAAGGGTAGG - Intronic
1200875093 Y:8146223-8146245 CCGCCTCAGCCCCCAAGGATTGG - Intergenic
1201722291 Y:17112866-17112888 CCTGAGCTGCTTCCATGGATGGG - Intergenic