ID: 998015021

View in Genome Browser
Species Human (GRCh38)
Location 5:138724992-138725014
Sequence GGAAGCACAAAGTCTCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998015021_998015036 30 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015036 5:138725045-138725067 CTGGACCTGAGGAAAAAGGTGGG 0: 1
1: 0
2: 5
3: 30
4: 244
998015021_998015033 19 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015033 5:138725034-138725056 AGTCAGGGGAGCTGGACCTGAGG No data
998015021_998015026 3 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015026 5:138725018-138725040 CTTCCAGGAATCCTCCAGTCAGG 0: 1
1: 0
2: 1
3: 24
4: 201
998015021_998015030 11 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015030 5:138725026-138725048 AATCCTCCAGTCAGGGGAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 178
998015021_998015035 29 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015035 5:138725044-138725066 GCTGGACCTGAGGAAAAAGGTGG 0: 1
1: 0
2: 4
3: 31
4: 278
998015021_998015034 26 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015034 5:138725041-138725063 GGAGCTGGACCTGAGGAAAAAGG 0: 1
1: 0
2: 2
3: 35
4: 315
998015021_998015028 5 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015028 5:138725020-138725042 TCCAGGAATCCTCCAGTCAGGGG 0: 1
1: 0
2: 1
3: 13
4: 173
998015021_998015027 4 Left 998015021 5:138724992-138725014 CCAAGAGGAGACTTTGTGCTTCC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 998015027 5:138725019-138725041 TTCCAGGAATCCTCCAGTCAGGG 0: 1
1: 0
2: 1
3: 26
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998015021 Original CRISPR GGAAGCACAAAGTCTCCTCT TGG (reversed) Intronic
900646656 1:3711964-3711986 GGAAGCACAAAGGCTCTGCACGG + Intronic
902153273 1:14462084-14462106 CAAAGCTAAAAGTCTCCTCTTGG + Intergenic
903489181 1:23714971-23714993 GTGAGCACCAAGTCTCCTGTAGG + Intergenic
904493540 1:30874500-30874522 GGCAGCTCGAAGTCTCCACTGGG + Exonic
905731315 1:40301121-40301143 GGAAGGACCAGGTCCCCTCTGGG - Exonic
908218335 1:61978040-61978062 GGAGGCACAAAGTGACTTCTGGG - Intronic
910695244 1:90006519-90006541 GGGAGCACACAGTCTCCTCGAGG - Intronic
912406021 1:109438291-109438313 GGAAGCACAAAATCTTCTACTGG - Intergenic
913267488 1:117059689-117059711 GCAGGCACAAAGACTTCTCTAGG - Intergenic
921661476 1:217808151-217808173 GAAAGAACAAAGTCTCCTCCAGG + Intronic
922225915 1:223645827-223645849 GGAGGCACAAAGAGTCCTCCTGG + Intronic
922354532 1:224763443-224763465 GGAAGCACAAAGTCCCCAGTGGG + Intergenic
1063668337 10:8079839-8079861 CCAAGCACAAAGCCTCCTCCAGG - Intergenic
1068577202 10:58697893-58697915 GGAAGCACAAGGTCTCTACAGGG - Intronic
1070408498 10:76117665-76117687 GAAAGCACTCAGTCTCATCTTGG - Intronic
1072637029 10:97185089-97185111 CCAAGCACAATGTCTCCTTTTGG - Intronic
1073070456 10:100790246-100790268 GGACACATACAGTCTCCTCTAGG - Intronic
1073374041 10:103017610-103017632 GGAAGAGCAAAGACTCTTCTTGG + Intronic
1073387969 10:103143331-103143353 GGATGCAAAAAGCCTCCACTGGG + Intronic
1073622966 10:105067796-105067818 GGAAGGACAAAGACTCCTGAAGG - Intronic
1074001488 10:109378167-109378189 GGAAGCACAAAGGCGGTTCTTGG - Intergenic
1075522932 10:123154791-123154813 GCAAGCGCAGAGTCTCCTCGCGG + Intronic
1075908664 10:126104990-126105012 GGAAGCACCAAGTCTCCCAGGGG + Intronic
1078733939 11:14002623-14002645 CCAATCTCAAAGTCTCCTCTAGG - Intronic
1084203402 11:67577061-67577083 GGGAGGAAAAAGCCTCCTCTGGG + Intergenic
1084679380 11:70657485-70657507 GGACTCAGAAATTCTCCTCTAGG - Intronic
1086239660 11:84674315-84674337 GGAAGTAAAAAGTCTTCTCTTGG - Intronic
1086954875 11:92925579-92925601 GGAAACACAGAGTCCCCACTGGG + Intergenic
1090429958 11:126637402-126637424 GGAAGCACAACGTCTGCAGTGGG - Intronic
1090493041 11:127182615-127182637 GGAAGCATACACTCTCTTCTTGG - Intergenic
1092146321 12:6217179-6217201 GGGAGCACAAAGAGTCCCCTGGG + Intronic
1092533194 12:9362070-9362092 GGAGGCACGAAGTCTCTTCTCGG + Intergenic
1093008123 12:14073357-14073379 GGAAGCTCAAAGACTGCTCCAGG - Intergenic
1095129440 12:38521676-38521698 GGAATCTGAAAGTGTCCTCTAGG - Intergenic
1096581427 12:52587987-52588009 GGAAGGACAGACTCACCTCTAGG - Intronic
1097350654 12:58545085-58545107 TTAAGCACAAAGGCTCCTCAAGG - Intronic
1098261119 12:68672123-68672145 AGAAGCAGAAAGACTTCTCTAGG + Intergenic
1099864944 12:88268440-88268462 GGAAGCACAGAGTCTCTTAACGG - Intergenic
1102840458 12:116114473-116114495 TGAAGAAGAAAGTCTCTTCTGGG - Intronic
1107658883 13:42618901-42618923 GGAAGCAGGAAGGCTCCTTTTGG + Intergenic
1110241163 13:73268650-73268672 GGAAGCACAGAGCCTCCTGATGG - Intergenic
1110449969 13:75630351-75630373 AGAAGTACAAAATCTCCACTTGG + Intronic
1112588006 13:100736855-100736877 GAAAGCACAAAGGCTTATCTTGG + Intergenic
1112923780 13:104648403-104648425 GGCAGCACAATGCCTCCTTTCGG - Intergenic
1113174971 13:107553808-107553830 GGAAGCGCAATTGCTCCTCTGGG - Intronic
1115089352 14:29555300-29555322 GGAAACACAATGTTTCATCTAGG - Intergenic
1115941516 14:38615879-38615901 GTAAGCAAAAAGTCTTCTGTTGG + Intergenic
1116304425 14:43232260-43232282 GGAAGCACAAAATTTTCTCTCGG + Intergenic
1118884629 14:69856142-69856164 AGAAGAAGAAAGTCTCCTATTGG - Intronic
1119931214 14:78549196-78549218 TGAAGGACAAAGCATCCTCTTGG - Intronic
1123875122 15:24616723-24616745 CAAAGTTCAAAGTCTCCTCTGGG + Intergenic
1124193736 15:27602032-27602054 CGAAGCACAAAGCCACCTCAAGG + Intergenic
1124892850 15:33748711-33748733 AGAAGCGCAAAGCCTCCCCTTGG - Intronic
1125180036 15:36871950-36871972 GGAAGCAAAAAGATTCTTCTAGG + Intergenic
1127745158 15:61961777-61961799 GGAAACACGAAAACTCCTCTGGG + Exonic
1129113657 15:73352855-73352877 GGAAGCCCTAAGACTCCTCCTGG - Intronic
1133929788 16:10222874-10222896 AGAGGAACAAGGTCTCCTCTGGG - Intergenic
1135256900 16:20948372-20948394 GGAAGCCCAAGGTCACCCCTGGG + Intronic
1135721386 16:24821407-24821429 GAAAGCACAAAGGCTCCCGTTGG + Intronic
1136737181 16:32475585-32475607 GGATGCACAGACTCTCCTCTCGG - Intergenic
1137511095 16:49101530-49101552 GGAAGCACAAATTCCCCAATAGG + Intergenic
1139013316 16:62659765-62659787 GGAAGTACAAACTCTCTACTTGG - Intergenic
1203015889 16_KI270728v1_random:353992-354014 GGATGCACAGACTCTCCTCTCGG + Intergenic
1203034224 16_KI270728v1_random:627150-627172 GGATGCACAGACTCTCCTCTCGG + Intergenic
1142866870 17:2796538-2796560 GGAAGCGCAGTGTCTCCTTTGGG + Exonic
1143544164 17:7586793-7586815 GGAACCACACAGCCTGCTCTTGG - Intronic
1144562218 17:16330204-16330226 GTATTCAAAAAGTCTCCTCTTGG + Intronic
1149436392 17:56637169-56637191 GGAAGCCCAAATCCTCCTCCTGG - Intergenic
1152730224 17:81966520-81966542 TGAAGCACAGAGTCCCCTCTGGG - Intergenic
1152930134 17:83105081-83105103 CGAGGCACAGACTCTCCTCTGGG + Intergenic
1153175264 18:2364890-2364912 AGAAGCACAAAGTTTTCTCTTGG + Intergenic
1153199003 18:2630499-2630521 GGAAGCACAAATTCCCCAGTGGG - Intergenic
1154300560 18:13187658-13187680 GGCAGGACACAGTCTCCTCTGGG - Intergenic
1157293878 18:46427963-46427985 GGGAGCACAAACTCTCCAGTGGG + Intronic
1159062847 18:63533999-63534021 GGATGCACAAACACTGCTCTGGG + Intergenic
1159816662 18:73082605-73082627 TTAAGCAGAGAGTCTCCTCTTGG + Intergenic
1160618003 18:80148438-80148460 GGGAGCACCGAGTCTCCTCAGGG - Intronic
1161149596 19:2701077-2701099 GGAAGGAGAAAGGCTCCTGTCGG - Intronic
1163218031 19:15895139-15895161 GGAAGAACAAGGTCTCTGCTGGG - Intronic
1164901845 19:31934174-31934196 GGAAGCAAGAAGTACCCTCTAGG + Intergenic
1166405770 19:42520969-42520991 GGAAGCAGAAAGGGTCCTCAAGG - Intronic
1167095152 19:47371393-47371415 TGAAACACAAAGCATCCTCTTGG + Intronic
926734525 2:16062846-16062868 CCAAGCCCAAAGTCTCATCTGGG + Intergenic
930741800 2:54839214-54839236 AGAACCACACAGTCTCTTCTGGG - Intronic
933402409 2:81815357-81815379 ACAAGCAAAAAGTCTCTTCTAGG - Intergenic
933662623 2:84940036-84940058 GAAAGCACAAAGCCTTCTGTGGG + Intergenic
933796530 2:85924464-85924486 GGAAGGGCAAAGTCTCCCCCAGG - Intergenic
934308288 2:91843255-91843277 GGGTGCACAGACTCTCCTCTCGG + Intergenic
937317692 2:120942322-120942344 GCAAGGACAGAGTCTCCCCTGGG - Intronic
940001429 2:148970136-148970158 GAAACCACAAAGTCTGCTGTAGG + Intronic
940020648 2:149152978-149153000 GGAAGCACTAAGTCCCCTAATGG + Intronic
944887801 2:204082718-204082740 GGATGCTCCAAGTCTGCTCTAGG - Intergenic
945147610 2:206754923-206754945 GGAAGAACACTGTCCCCTCTAGG - Intronic
947835105 2:233169664-233169686 TAAAGCAGAAAGCCTCCTCTGGG + Intronic
948106547 2:235419067-235419089 GGAAGCAAACAGACTCCCCTGGG - Intergenic
1168767886 20:394468-394490 GGAAGCACGCTGTCTCCTCCAGG - Intronic
1168808719 20:688872-688894 GGAAGTTCAAGGTCACCTCTGGG + Intergenic
1170219561 20:13927819-13927841 TGAAGTTCAAACTCTCCTCTAGG + Intronic
1171024677 20:21618807-21618829 GGAAGCACAAAGTAGCTTCTGGG - Intergenic
1171881252 20:30618724-30618746 CAAAGTACAAAGTCTCATCTGGG + Intergenic
1173610433 20:44363499-44363521 GGATGCCCAGGGTCTCCTCTTGG + Intronic
1173683812 20:44909043-44909065 GGAAGCACTAATTCTAATCTTGG - Intergenic
1177001258 21:15615980-15616002 GGAAGCCCGAAGTCTCATCTAGG - Intergenic
1178014296 21:28325774-28325796 GAAAGTACAGACTCTCCTCTAGG + Intergenic
1179591225 21:42410018-42410040 GGAAGCACAAACTCTGTTTTAGG - Intronic
1180535146 22:16389323-16389345 GGAAGCATAATCTCTACTCTGGG + Intergenic
1180535373 22:16390334-16390356 GGGTGCACAGACTCTCCTCTCGG + Intergenic
1180916785 22:19494376-19494398 GGAAGCACAGACTCACCTCCGGG - Exonic
1182650620 22:31848311-31848333 GGAAGGAAAAAGTCTCCACTGGG - Intronic
1183339960 22:37274539-37274561 GGAAGCCCAAGGTCTCCTGCGGG - Intergenic
1184130124 22:42512672-42512694 GGAAGGACAAGTCCTCCTCTCGG + Exonic
1184140302 22:42574489-42574511 GGAAGGACAAGTCCTCCTCTCGG + Intergenic
1185003670 22:48262715-48262737 GGAAGGACACAGCCTCCCCTTGG - Intergenic
949124123 3:425087-425109 AGAAGCACATAGTCTACTGTCGG - Intergenic
950431371 3:12952988-12953010 GGAGGCAGAAATCCTCCTCTGGG + Intronic
953109807 3:39922993-39923015 GGAAGTACAAAGTCTCCGCGAGG + Intronic
954649623 3:52153334-52153356 GGAAGCCCAAAGGCTCCTCCTGG + Intronic
954830597 3:53418091-53418113 GGAAGTACAAATTCTCCTAGTGG + Intergenic
954972207 3:54660788-54660810 GGGAGCACAAAGGCTCTTGTGGG - Intronic
955225485 3:57056892-57056914 CAAAACACAAAGGCTCCTCTTGG + Intronic
956657172 3:71563680-71563702 AGAGTTACAAAGTCTCCTCTGGG - Intronic
957393953 3:79616571-79616593 GGAAGCACACAGTCACCTTCTGG - Intronic
959560979 3:107780613-107780635 GGCAGAACAAAATCTCATCTTGG - Intronic
960644863 3:119868444-119868466 TGAAGGACAAAGTCTATTCTAGG - Intronic
961545809 3:127632161-127632183 GGAAGGAAACAGGCTCCTCTGGG + Intronic
961556405 3:127699118-127699140 GGGACCCCAAAGCCTCCTCTTGG + Intronic
964396150 3:156248083-156248105 GGAGGGACAAAGTCTTCTCAAGG - Intronic
965667918 3:171115741-171115763 GGAGGTACACATTCTCCTCTAGG - Intronic
966849756 3:184156904-184156926 GGGAGAAGAATGTCTCCTCTTGG - Intronic
967393750 3:188983255-188983277 GGCAGCACAAAGGCTCCTTGTGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970013360 4:11484850-11484872 GGAAGCACATGGTCTACTCTGGG - Intergenic
970340459 4:15100996-15101018 GGCAGCACAAGGTCACCACTTGG + Intergenic
975200571 4:71583551-71583573 GGAAGAACATAGTTTCTTCTTGG - Intergenic
976217139 4:82726041-82726063 GGAAGGATGAAGTCTCCACTGGG - Intronic
977175623 4:93816349-93816371 TGAGGCACAATGTCTTCTCTGGG - Intergenic
982099891 4:151957558-151957580 GGAGGCACTCATTCTCCTCTCGG + Intergenic
982824491 4:159985210-159985232 GGAAGCTGACAGTATCCTCTGGG + Intergenic
983369155 4:166837090-166837112 GGAAGGAGAAAGTCCTCTCTGGG - Intronic
984185318 4:176536495-176536517 GGAAGCACAAAGTCTCCTGACGG + Intergenic
985215596 4:187650248-187650270 AGAAGCACAAATTCTCCAGTGGG - Intergenic
986456634 5:7927011-7927033 GGCAGGACAAAGTCTCTTCCAGG + Intergenic
988930412 5:36031195-36031217 GGAAGCACAATGCCTTCTTTAGG + Intergenic
990216691 5:53540818-53540840 GAAAGAACAAACTCTCCTCAGGG + Intergenic
991411390 5:66348791-66348813 GAAATCACAGAGTCTCCTTTTGG - Intergenic
993651086 5:90522994-90523016 TGAATCACAAACTCTCCTCTCGG + Intronic
998015021 5:138724992-138725014 GGAAGCACAAAGTCTCCTCTTGG - Intronic
999545456 5:152624046-152624068 GGAAGCAAAAATTCTGCTGTTGG - Intergenic
1001854947 5:175003022-175003044 CAAAGCACATAGTCTCCTCGAGG + Intergenic
1001961200 5:175881061-175881083 CCAAGGACAAACTCTCCTCTGGG + Exonic
1003656111 6:8010276-8010298 GGAAGAAAAACGTCTCCTCTGGG + Intronic
1006310280 6:33252872-33252894 GGAAGCACATAATGTCTTCTTGG - Intronic
1006995245 6:38253652-38253674 GGAAGTACAAGGTCTGGTCTGGG + Intronic
1007812901 6:44498860-44498882 GGAAGTAGAATGTCTCTTCTGGG - Intergenic
1012333827 6:98028945-98028967 AGAAGCACCAAATATCCTCTTGG - Intergenic
1013830100 6:114261765-114261787 AGAAGGACAAAGCCTCCTCCAGG + Intronic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1022780776 7:33580525-33580547 GGAAAAACAAAGTCTTTTCTTGG - Intronic
1026452368 7:70540483-70540505 GGAAGCACACAGTCGTCTCTGGG + Intronic
1027510915 7:79078527-79078549 AAAATCACAAAGTCTACTCTTGG + Intronic
1029418211 7:100456751-100456773 GGATGCCCAAAGTCCCCTCTAGG - Exonic
1032546328 7:132746744-132746766 GGAAGCCCAAATTTTCCTCCTGG + Intergenic
1033865427 7:145685802-145685824 GAAAGCACGAAGTCTCCCATTGG - Intergenic
1034100213 7:148444495-148444517 GGAAGAACAAAGCCTCCACAGGG + Intergenic
1035117505 7:156537075-156537097 GGAAGCACCAAGTCTCCCAATGG + Intergenic
1038931686 8:32200725-32200747 GGAAGCAGAAAGTCCCTCCTCGG + Intronic
1039126660 8:34210745-34210767 TGAATCTCAAAGTCTACTCTAGG - Intergenic
1039731722 8:40286750-40286772 GGAAGCATACAGTGTCCCCTGGG - Intergenic
1041307678 8:56479500-56479522 GGAAGCACACAGTCTTCACATGG - Intergenic
1042363934 8:67914788-67914810 TGAAGCACACATTTTCCTCTGGG + Intergenic
1045109703 8:98928774-98928796 GGAAGCACAAATTCCTCACTTGG + Intronic
1046718875 8:117596737-117596759 AGAAGCACAAATTCCCATCTAGG - Intergenic
1047071158 8:121344915-121344937 AGAAGAACAAAGGCTTCTCTAGG - Intergenic
1047916392 8:129588366-129588388 GTAAGGCCAAAGTCTCCTTTAGG - Intergenic
1048026775 8:130594478-130594500 GTAAGCACAAAGTAGCCACTTGG + Intergenic
1048613054 8:136044674-136044696 GGAAGCATCAAGTCTCCCCTTGG - Intergenic
1049495038 8:142926056-142926078 GGGAGCACAGAGACTCCTCAGGG + Intergenic
1055091572 9:72368898-72368920 TGAAGCACAAAGCCTTTTCTAGG + Intergenic
1055718574 9:79146041-79146063 AGAACCACAAACTCTACTCTAGG - Intergenic
1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG + Intergenic
1056965715 9:91161582-91161604 GGAATCAAAAACTCTCCTCCTGG + Intergenic
1060944233 9:127560495-127560517 GGAAACACAAAGGCTGGTCTTGG - Intronic
1061356417 9:130108953-130108975 GGAAGTACAAATCCACCTCTAGG + Intronic
1061625980 9:131840928-131840950 GGAAGCAGAAACTCTCCTGAGGG + Intergenic
1186306411 X:8264413-8264435 GGTAGCACAAATTCTTCTCTGGG + Intergenic
1191586206 X:62829276-62829298 GGAAGCAGGAAGTCTGGTCTAGG + Intergenic
1194338692 X:92682228-92682250 GGCATCACAAAGCCTGCTCTGGG - Intergenic
1195977725 X:110545629-110545651 GGAAGCTCACAGTCTTCTATGGG + Intergenic
1196359830 X:114839811-114839833 AGAACCACAAATTCTTCTCTGGG + Intronic
1198170992 X:134105041-134105063 GGGAGCCCAAATTCTCCTTTTGG + Intergenic
1199190085 X:144960962-144960984 GGAAGCAAAAAGTATCTACTTGG - Intergenic
1200111500 X:153743185-153743207 GGGTGCACAGACTCTCCTCTCGG + Intronic
1200647082 Y:5799010-5799032 GGCATCACAAAGCCTGCTCTGGG - Intergenic