ID: 998016096

View in Genome Browser
Species Human (GRCh38)
Location 5:138733622-138733644
Sequence TTTCCTGACCACCCAGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998016096_998016099 -7 Left 998016096 5:138733622-138733644 CCTTAGACTGGGTGGTCAGGAAA 0: 1
1: 0
2: 6
3: 31
4: 346
Right 998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998016096 Original CRISPR TTTCCTGACCACCCAGTCTA AGG (reversed) Intronic
900828676 1:4948356-4948378 TTTCCATCCCACCCAGACTATGG - Intergenic
902086581 1:13867532-13867554 CTTCCTGACCACCCTGGCTGGGG + Intergenic
902506801 1:16943950-16943972 TTCCCTGACCACCCTGTCCATGG - Intronic
903425433 1:23250713-23250735 TTTACAAACTACCCAGTCTATGG - Intergenic
903581352 1:24373214-24373236 TTTCCGGAGCACCCACTCCACGG - Intronic
903686023 1:25132629-25132651 TTTCCTGAGCACCCAGTAAATGG + Intergenic
905945738 1:41900304-41900326 TTTACTGACCACCCAGTACCAGG - Intronic
907381899 1:54097734-54097756 TTTCCTGAGCATCCATTCTGTGG + Exonic
907756309 1:57314022-57314044 TTTACAAACCACCCATTCTATGG + Intronic
907822681 1:57986497-57986519 TTTCTAAGCCACCCAGTCTATGG + Intronic
908158915 1:61386811-61386833 TTTATAGACCACCCAGTCTATGG - Intronic
909131569 1:71743154-71743176 TATTCAAACCACCCAGTCTATGG + Intronic
909239111 1:73190389-73190411 TTTGTAAACCACCCAGTCTATGG - Intergenic
909352036 1:74665321-74665343 TTTCTAAGCCACCCAGTCTATGG + Intronic
909707495 1:78604807-78604829 TTTATAGGCCACCCAGTCTATGG + Intergenic
910853464 1:91670861-91670883 TTCCCCCATCACCCAGTCTATGG - Intergenic
911182066 1:94870061-94870083 TTTTGTGAACACCCAGCCTAAGG + Intronic
913721904 1:121604742-121604764 TTTCCTGATCAGCCTGGCTAGGG + Intergenic
913741688 1:121852324-121852346 TTTCCTGATCAGCCTGGCTAGGG + Intergenic
914387598 1:147186653-147186675 GTACCTGAGCTCCCAGTCTAGGG + Exonic
914438947 1:147685780-147685802 TTTATTAATCACCCAGTCTAAGG + Intergenic
916585585 1:166147106-166147128 TTTCCTGACCACCTCTCCTAGGG - Intronic
916955835 1:169833649-169833671 GTTCCTGGCCAACCACTCTAGGG - Intronic
917499753 1:175575620-175575642 TTTCCTCACTACCCAATCTGAGG - Intronic
917793420 1:178514328-178514350 TTTCCCTACCACCCACTCCACGG - Intronic
918635594 1:186770687-186770709 TGTGCAAACCACCCAGTCTATGG - Intergenic
919073842 1:192790221-192790243 TTTTCTTAGCACCCACTCTATGG + Intergenic
919751255 1:201039684-201039706 GTTCCTGACCACCCTGCCTCAGG + Exonic
921575485 1:216830248-216830270 TTTCCTGACCACTGAGGCCACGG + Intronic
922471371 1:225879368-225879390 TTTCCTGACCAGCGAGTCCTGGG + Exonic
922506567 1:226129479-226129501 TTTCTTTTCCACCCAGTCTGTGG + Intergenic
922507492 1:226135006-226135028 TTTCCTGACCTCTCAAGCTAAGG + Intergenic
923057163 1:230435682-230435704 TTTCCTGAGAACCCTGTTTAAGG + Intergenic
923068219 1:230539396-230539418 TTTCCAGAGAACCCAATCTAGGG + Intergenic
923959800 1:239066430-239066452 TTTATAAACCACCCAGTCTATGG - Intergenic
1063057167 10:2518379-2518401 TTTCCTAACCTCTTAGTCTATGG + Intergenic
1064221248 10:13442084-13442106 TTTCCTGACTACCCTGTCCAAGG - Intronic
1064600253 10:16985760-16985782 TTCCCTGACCACCCCGTCGCAGG - Intronic
1065783176 10:29189634-29189656 TGTTCAGGCCACCCAGTCTATGG - Intergenic
1065815554 10:29479616-29479638 TTTCCTGAGCACCTACTCTACGG - Intronic
1065957382 10:30705590-30705612 TTTCCTGAGCATCTACTCTATGG + Intergenic
1067689351 10:48491386-48491408 TTTCCTGACCACCCTATTTAAGG + Intronic
1067879696 10:50032702-50032724 TTTCCTGCCCACACAATCTTGGG - Intergenic
1067997275 10:51287643-51287665 TTCCCTGACCACCTTCTCTAAGG - Intronic
1068110628 10:52676069-52676091 TCTCCTAACCACCTATTCTAAGG - Intergenic
1068855736 10:61795532-61795554 TTTCTTAAGCACCCAGTCTGTGG + Intergenic
1071709299 10:88033782-88033804 TTTCCAGAGAACCCAATCTAAGG - Intergenic
1071889249 10:89984704-89984726 TTTACCAGCCACCCAGTCTACGG - Intergenic
1073862749 10:107766358-107766380 CTTCCGGGCCACACAGTCTATGG + Intergenic
1074513629 10:114142767-114142789 GTTCCTGCCCACCAAGTCTTAGG - Intronic
1074835085 10:117283999-117284021 TTTCCTGTCCTTCCAGCCTAAGG + Exonic
1076041916 10:127257393-127257415 GTTCATGATCACCCAGTCGAAGG - Exonic
1076309909 10:129497954-129497976 TTTACAAAGCACCCAGTCTAAGG + Intronic
1077580339 11:3413443-3413465 TGTCCTGAGCACCCAGTTGATGG - Intergenic
1077664880 11:4098887-4098909 TTTCCTGGCTACCCAATCCAAGG - Intronic
1078350244 11:10586966-10586988 TTTCCTGAGAACCCAGTGTTTGG + Intronic
1078434466 11:11313043-11313065 TTTCCTGACCATCCTATCTAAGG - Intronic
1078550496 11:12276931-12276953 TTTCCTGGCCACCCAATCTAAGG - Intronic
1079816077 11:25060184-25060206 TTTATAAACCACCCAGTCTATGG - Intronic
1080693751 11:34582892-34582914 TTTGTTGACCACCCAGACCAAGG - Intergenic
1081157047 11:39705919-39705941 TGACATGACCACCCAGGCTATGG + Intergenic
1083297903 11:61725102-61725124 TCTCCTGACCACCCAGCATCAGG + Intronic
1083300239 11:61736254-61736276 GTTCCTGCCCACCCAGGGTATGG + Exonic
1083354637 11:62057095-62057117 TTTACAAGCCACCCAGTCTATGG + Intergenic
1084237266 11:67796271-67796293 TGTCCTGAGCACCCAGTTGATGG - Intergenic
1084835136 11:71796557-71796579 TGTCCTGAGCACCCAGTCAATGG + Intronic
1086520906 11:87666697-87666719 TTTCCTGACCATTCTGTCTGAGG - Intergenic
1087130743 11:94667581-94667603 TTTACAAAGCACCCAGTCTATGG + Intergenic
1089623656 11:119737615-119737637 CTTCCTGACCCCCTAGACTAGGG - Intergenic
1090732008 11:129580370-129580392 TTTCTGGTGCACCCAGTCTATGG + Intergenic
1090916016 11:131163165-131163187 ATTCCTGACAACTCGGTCTAAGG + Intergenic
1091656429 12:2349831-2349853 TTTCCTGAGCACCTAGTACATGG - Intronic
1091869069 12:3872395-3872417 TTTCCTCACCACCCATTGTAAGG - Intronic
1092068856 12:5616188-5616210 TTTCTTGAACACTCAGTTTATGG - Intronic
1092370019 12:7909081-7909103 TTCCGAGACCACCCAGGCTAGGG - Intergenic
1092407932 12:8233864-8233886 TGTCCTGAGCACCCAGTTGATGG - Intergenic
1094090587 12:26644853-26644875 TTTACAAGCCACCCAGTCTATGG + Intronic
1095216114 12:39550528-39550550 TTTCCTGACTACCAAGTTCAGGG - Exonic
1098169573 12:67733053-67733075 TTTCCTGACCGGTCGGTCTAGGG + Intergenic
1099611489 12:84877687-84877709 TTCCCTGACCACCCAAAATAAGG + Intronic
1100990528 12:100246283-100246305 TTACCTGACCACCTAGTCTGAGG - Intronic
1102499930 12:113344969-113344991 TTTCCAAACCACCCAATCTATGG + Intronic
1102643022 12:114383207-114383229 TGGGCTGACCACACAGTCTATGG + Intronic
1102703203 12:114858175-114858197 TTTTTTGGCCACCCAATCTAGGG - Intergenic
1103555065 12:121761365-121761387 TTCCCTGACCACTCAGCCCAGGG - Intronic
1104006328 12:124895370-124895392 TTCCCTGACCTCCCAACCTAAGG - Intergenic
1105958183 13:25303611-25303633 TTTTCTGACCTGTCAGTCTAGGG + Intronic
1106681580 13:32013824-32013846 TTCCCTGACCACCCAATATAAGG - Intergenic
1107634029 13:42373609-42373631 TTGCCTGGCCACCCACTCGAGGG - Intergenic
1107857759 13:44632298-44632320 CTTTATGACTACCCAGTCTATGG + Intergenic
1107918997 13:45183885-45183907 TTTCTTGGTCACCCAGGCTAGGG + Intronic
1108259609 13:48643745-48643767 TTTCTGTTCCACCCAGTCTATGG - Intergenic
1110471389 13:75863891-75863913 CATCCTGACCACCCCGTCTGTGG + Intergenic
1111851380 13:93580052-93580074 TTTACAGACCACCCAGTCTATGG - Intronic
1112763618 13:102718021-102718043 TTTACAAACCACCCAGTCTGTGG + Intergenic
1113109694 13:106809582-106809604 CTTCCTCACCACCCAGGTTATGG + Intergenic
1113325978 13:109281862-109281884 TTGCCTGGACTCCCAGTCTACGG + Intergenic
1114232206 14:20793305-20793327 TGTCTAAACCACCCAGTCTATGG - Intergenic
1114894799 14:26974253-26974275 CTTCCTGCCCACTCAGTGTATGG - Intergenic
1117302893 14:54445898-54445920 TTTCCTCACTACCTTGTCTATGG - Intergenic
1118349362 14:64962561-64962583 TTCTCTGGCCAGCCAGTCTAAGG - Intronic
1120455792 14:84728926-84728948 TCTGTTGACCACCCAGTCTATGG + Intergenic
1121174351 14:91879563-91879585 TTTCCAGGCCACCCCGTCTGTGG - Intronic
1121276160 14:92669354-92669376 TTCCCTGACCACCCAGTCCCAGG - Intronic
1121796489 14:96740429-96740451 TTTCCGGGCCCTCCAGTCTAGGG - Intergenic
1122123327 14:99566180-99566202 TTTCCTGACCACCCACTCGGTGG + Intronic
1122288913 14:100668989-100669011 TCTCCTGAGCACCCAGTCCCTGG + Intergenic
1123458099 15:20444125-20444147 TGTCCTGACATCCCATTCTAAGG + Intergenic
1123659969 15:22556284-22556306 TGTCCTGACATCCCATTCTAAGG - Intergenic
1124313830 15:28650779-28650801 TGTCCTGACATCCCATTCTAAGG - Intergenic
1127160370 15:56177275-56177297 TTTCCTGGCCACCCTATCTAAGG + Intronic
1127314055 15:57777931-57777953 TTTGCTGGCCACCCTGTCTCAGG + Intronic
1128877092 15:71211278-71211300 TTGCTTAAGCACCCAGTCTATGG - Intronic
1131328361 15:91470534-91470556 CTGCGTGACCATCCAGTCTATGG - Intergenic
1131502538 15:92982902-92982924 TTTATAAACCACCCAGTCTACGG - Intronic
1131714801 15:95096729-95096751 GTTCCTGTCCACTCTGTCTATGG + Intergenic
1133003053 16:2860741-2860763 CTTCCTGGCCACCCTGTCTCAGG - Intergenic
1133155083 16:3868674-3868696 CTCCCTGACCACCCAGCCTGAGG + Intronic
1133348878 16:5088694-5088716 TGTCCTGAGCACCCAGTCGGTGG - Intronic
1135114682 16:19714612-19714634 TTTCCTCCTCACCCTGTCTAGGG + Exonic
1135345939 16:21688533-21688555 TTTACTAGCCACACAGTCTATGG - Intronic
1140326802 16:74012357-74012379 TTTTTTGACCACCCAGTATCTGG - Intergenic
1140574211 16:76145893-76145915 TTTATACACCACCCAGTCTATGG + Intergenic
1141313697 16:82939889-82939911 TTTCCTTATTACCCAGTCGAGGG - Intronic
1141928391 16:87184311-87184333 TTTCCTGACCATCCAATCCAAGG - Intronic
1144001956 17:11063566-11063588 TTTATAAACCACCCAGTCTATGG - Intergenic
1144079099 17:11746173-11746195 TTTCCTGACTACCCAGTCTCAGG - Intronic
1148518791 17:48248752-48248774 CTTCCTGATCACACAATCTAAGG - Intronic
1149306046 17:55347436-55347458 TTTCCTGAGGACCCAGACTTAGG - Intergenic
1149380771 17:56091751-56091773 TTTCTTGACCACATAGTCTCTGG - Intergenic
1150477673 17:65487297-65487319 TTTCTAAACTACCCAGTCTAAGG - Intergenic
1150811331 17:68359542-68359564 TTTCTTGACCACTTAGGCTAAGG - Intronic
1151191337 17:72400212-72400234 TTTCCAGACCCCTCAGTTTAGGG + Intergenic
1151532868 17:74718356-74718378 TATCATATCCACCCAGTCTATGG + Intronic
1151817383 17:76477954-76477976 TTTCCTGGCCTTCCAGTCTCAGG - Intronic
1152373589 17:79905939-79905961 TTTCTACACCACCCAGTTTATGG + Intergenic
1155412913 18:25565835-25565857 TTTCCTGATCAGCCAGTAAAAGG - Intergenic
1155478731 18:26262270-26262292 TCTCCTAACCTCCCAATCTAAGG - Intronic
1155838988 18:30624925-30624947 TTTACAATCCACCCAGTCTATGG + Intergenic
1157409844 18:47454498-47454520 TGTTTTGACCACCCAGTCTATGG + Intergenic
1157465033 18:47936401-47936423 TCCCTTGACCACCCTGTCTAGGG + Intergenic
1157826193 18:50814499-50814521 TCTCCTTACCACACAGTCTGTGG - Intronic
1158643621 18:59223390-59223412 TCTCCTTAGCAACCAGTCTATGG + Intronic
1158842835 18:61406636-61406658 TTTCTCAACCACCCTGTCTAAGG - Intronic
1159810569 18:73013781-73013803 TTTACAAGCCACCCAGTCTATGG - Intergenic
1161580778 19:5079645-5079667 TTCCCTGACCACCTGCTCTAAGG - Intronic
1163338140 19:16687018-16687040 TTTCTAAGCCACCCAGTCTATGG - Intronic
1165711084 19:38011543-38011565 TTCCCTGACCACCCAGATCAGGG - Intronic
1165930412 19:39354678-39354700 TTCCCTGACCATCCAATCTCAGG - Intronic
1168311385 19:55462577-55462599 TTTCCTGACCACCTGGTGTCAGG + Intergenic
1168526436 19:57092138-57092160 TTTATAAACCACCCAGTCTATGG - Intergenic
1168545366 19:57245331-57245353 TTCCCTGACCACCGAATCTTGGG + Intronic
925479413 2:4253321-4253343 TTTCTTGACAAGCCAATCTATGG + Intergenic
925572273 2:5325180-5325202 TTTCATGACCATCCAGTGGAAGG - Intergenic
925697720 2:6598850-6598872 TTTCCTGGCCACCCAGCCCCAGG + Intergenic
927469549 2:23362749-23362771 TTTCCAGACTACCCTGTCTGTGG - Intergenic
927928341 2:27028029-27028051 TTTCCTCACCACCCTGAGTATGG + Intergenic
928021517 2:27708653-27708675 TTCCCTGACCACCCTGTATAGGG + Intronic
928113130 2:28526257-28526279 TTTCCTGCCCACCCAGACCCAGG + Intronic
928764165 2:34621917-34621939 TTTACAATCCACCCAGTCTATGG + Intergenic
928889662 2:36189036-36189058 TTCCCTTAGCTCCCAGTCTAAGG + Intergenic
929474907 2:42236579-42236601 TTTGCAGACCACACAGTCTGTGG - Intronic
929575859 2:43051255-43051277 TTTCCAGACTTCCCAGTCTGAGG - Intergenic
929622668 2:43372104-43372126 TTAGCTGACCACACAGTCTTTGG - Intronic
930240373 2:48929901-48929923 TTTCCTGACAACACGGTATAAGG - Intergenic
930618906 2:53624282-53624304 TTTATAAACCACCCAGTCTATGG + Intronic
931667893 2:64623371-64623393 TTTCCCGACCGCCCTGCCTAAGG - Intergenic
931967907 2:67553852-67553874 TTTGTAAACCACCCAGTCTATGG - Intergenic
932123337 2:69121094-69121116 TTTCCTGACCTCCCAGATGAGGG + Intronic
932680979 2:73825417-73825439 TTCTCTGACCACCCATTCTAAGG - Intergenic
933537383 2:83592956-83592978 TTTACAAACCACCCAGTCTCAGG + Intergenic
934166795 2:89301390-89301412 TTTACTGATTACCCAGTCTCAGG + Intergenic
934200485 2:89881067-89881089 TTTACTGATTACCCAGTCTCAGG - Intergenic
935402809 2:102678251-102678273 TTTTCTGAGCACCCATTCTGAGG - Intronic
937923967 2:127153748-127153770 TTTAGAGACCACCCAGTCAAGGG + Intergenic
938109846 2:128556602-128556624 TTTCTAAGCCACCCAGTCTATGG + Intergenic
938504485 2:131863197-131863219 TTTACAAATCACCCAGTCTAAGG - Intergenic
938782680 2:134599585-134599607 TTTCTAAGCCACCCAGTCTATGG + Intronic
941495216 2:166191956-166191978 TGTTCTAGCCACCCAGTCTATGG + Intergenic
941549884 2:166901840-166901862 TTTCCTGACTGTTCAGTCTATGG + Intronic
942161098 2:173188502-173188524 TGTCATCACCACCCATTCTAAGG - Intronic
943266711 2:185740606-185740628 TTTCTAAGCCACCCAGTCTATGG - Intronic
943812767 2:192210032-192210054 CTTTCTGACCACCCATTCTCTGG - Intergenic
944652691 2:201847632-201847654 TTTCCTGACCACACATTCCCAGG - Intronic
1168803241 20:657399-657421 TTTATAAACCACCCAGTCTATGG - Intronic
1169248490 20:4042462-4042484 GTTTCTGTCCACCCAGTGTATGG - Intergenic
1170095582 20:12642445-12642467 TTCCCTGACCACTCAGTGCAGGG + Intergenic
1170766017 20:19290637-19290659 TTTATAGGCCACCCAGTCTATGG + Intronic
1171418804 20:25002885-25002907 TTTCCAGGCAACCCAGGCTAAGG + Intergenic
1173193427 20:40894398-40894420 TTTCCTGACCTCTAAGTCTGTGG - Intergenic
1173826762 20:46052814-46052836 TTTTCTGACCACTCAGCCCATGG + Intronic
1174662111 20:52222313-52222335 TTTACAAACCACCCAGTCTCGGG - Intergenic
1175227357 20:57452382-57452404 TTCTCTGACCACCCTGCCTAAGG - Intergenic
1178010192 21:28275989-28276011 TTCACAGGCCACCCAGTCTATGG - Intergenic
1179834610 21:44021995-44022017 TTTCTAAGCCACCCAGTCTATGG + Intronic
1181730745 22:24844602-24844624 TTTCCTGACCACACTGTCTAAGG - Intronic
1181735157 22:24875844-24875866 ATTCCTGACCAGCCACTCTCAGG - Intronic
1182926149 22:34127041-34127063 ATCCCTGCCCACCAAGTCTAAGG - Intergenic
1183241079 22:36658837-36658859 AGTCCTGACCACCCAACCTAAGG - Intronic
1183705560 22:39473214-39473236 TTTACAGACCACCCAGTCTCAGG - Intronic
1184066408 22:42124192-42124214 TGTCCTTACCTCCCAGTCTGGGG - Intergenic
1184068876 22:42136344-42136366 TGTCCTTACCTCCCAGTCTGGGG - Intergenic
1184675488 22:46040489-46040511 TGTCCTCACCACCCTGTCCAGGG - Intergenic
1184987308 22:48144632-48144654 TTTCCTGACCAGCCCATCCATGG - Intergenic
1185116353 22:48940433-48940455 TTCCCTGACCACCCTGCCTCAGG - Intergenic
950553625 3:13682352-13682374 TGTCCTGACCAGCCACTCTCTGG - Intergenic
950562687 3:13744103-13744125 GCTCCTGACTACCCAGTCTAAGG + Intergenic
950842413 3:15980121-15980143 TTTATAAACCACCCAGTCTATGG - Intergenic
951884585 3:27511427-27511449 TTTATAAACCACCCAGTCTATGG + Intergenic
951908435 3:27725618-27725640 TTATTTGCCCACCCAGTCTAAGG - Intergenic
954525935 3:51271284-51271306 TTTACATGCCACCCAGTCTATGG - Intronic
956225279 3:66950556-66950578 TTTATGAACCACCCAGTCTATGG - Intergenic
956516041 3:70049301-70049323 TTTCCTGGCCACCCAGGAAAAGG - Intergenic
956747774 3:72323152-72323174 TTTTCAAGCCACCCAGTCTATGG - Intergenic
956822046 3:72962833-72962855 TTTTCTGATCACACAATCTAAGG - Intronic
957053211 3:75426040-75426062 TGTCCTGAGCACCCAGTTGATGG - Intergenic
957271082 3:78030717-78030739 TTTCCTGACCCCATAGTGTAGGG + Intergenic
960520924 3:118654456-118654478 TTTCATGACCACCCAGAATTTGG - Intergenic
961251855 3:125513866-125513888 TTTACAAATCACCCAGTCTATGG - Intronic
961301618 3:125925504-125925526 TGTCCTGAGCACCCAGTTGATGG + Intergenic
961886850 3:130102351-130102373 TGTCCTGAGCACCCAGTTGATGG - Intronic
963639375 3:147839525-147839547 TTTACATACCACCCAGTTTATGG - Intergenic
964999626 3:162936706-162936728 TTTTCTGACCACCCAGTCATTGG - Intergenic
968046558 3:195626986-195627008 GTTTCTGAGCCCCCAGTCTATGG + Intergenic
968308095 3:197663055-197663077 GTTTCTGAGCCCCCAGTCTATGG - Intergenic
968996014 4:3946356-3946378 TGTCCTGAGCACCCAGTCGGTGG - Intergenic
969220567 4:5755938-5755960 CTTTCTGACCACCCAGGCCATGG - Intronic
969757970 4:9162343-9162365 TGTCCTGAGCACCCAGTCGATGG + Intergenic
969817949 4:9699885-9699907 TGTCCTGAGCACCCAGTCGATGG + Intergenic
972314345 4:37912084-37912106 TTTCCACACTTCCCAGTCTAAGG + Intronic
972558634 4:40205621-40205643 TTTCCTGTCCTCCCAGACTGTGG + Intronic
972852886 4:43072273-43072295 TTTCCTGCCCACCCAATAAAAGG - Intergenic
973060042 4:45712504-45712526 TTTGCAAACCAGCCAGTCTAGGG - Intergenic
973307030 4:48663962-48663984 TTCCCTGACCACCCTATCTCAGG - Intronic
973542053 4:51944699-51944721 TTTACAAATCACCCAGTCTAAGG - Intergenic
973597517 4:52507583-52507605 TTTACTGAGCACCCACTATAGGG - Intergenic
973846074 4:54914467-54914489 CTCCCTGAGCACCCAGTCTTAGG + Intergenic
973990612 4:56403285-56403307 TTACCTGGCTACCCAGTCTGGGG + Exonic
974370236 4:61007322-61007344 TTCCCAAACCACCCATTCTAAGG + Intergenic
974677422 4:65111547-65111569 CTTACAAACCACCCAGTCTATGG + Intergenic
974849570 4:67388324-67388346 TTTCCAAGCTACCCAGTCTATGG - Intergenic
976120616 4:81776906-81776928 CTTCCTGACAAACCAGACTAAGG + Intronic
979494320 4:121367245-121367267 TTTCCAGGCCACCCAGACTGTGG - Intronic
979848309 4:125545021-125545043 TTTGCAAACCACCCAGTTTATGG - Intergenic
980338004 4:131500469-131500491 CTTCATCACCACCGAGTCTAAGG - Intergenic
980453525 4:133008336-133008358 TTTCCTGTCCTCCTATTCTAGGG + Intergenic
981398286 4:144280527-144280549 ATTCTTGACCACACAGTATAAGG + Intergenic
982436902 4:155390191-155390213 CTTCTTGACCTCCCAGGCTAGGG + Intergenic
982515682 4:156346048-156346070 TATCTTGATCACCAAGTCTAGGG - Intergenic
982858185 4:160412506-160412528 GTCCCTGACCACCCAGGCCAGGG + Intergenic
984215599 4:176909929-176909951 TTTATAAACCACCCAGTCTATGG - Intergenic
984289714 4:177780538-177780560 TTTACAAACAACCCAGTCTATGG - Intronic
984714130 4:182911052-182911074 TTTCTCAGCCACCCAGTCTATGG - Intronic
986760291 5:10874148-10874170 TTTATTAACCACCCAGTCTATGG + Intergenic
987770618 5:22299033-22299055 TTTCCTGACCAGCCTGATTAAGG - Intronic
989524063 5:42432866-42432888 TTTACTGAACACCTATTCTATGG - Intronic
989956441 5:50366335-50366357 TTTCCTGATCAGCCTGGCTAGGG - Intergenic
990167397 5:53009935-53009957 GTTGTTGGCCACCCAGTCTATGG + Intronic
991300068 5:65121401-65121423 TTTATAGGCCACCCAGTCTATGG - Intergenic
991954443 5:71978472-71978494 TTCCCTGACCATCCTATCTAAGG + Intergenic
992076276 5:73195683-73195705 TCTCCTGATCACCCAGCCCACGG + Intergenic
992202086 5:74394794-74394816 TTTCTAAGCCACCCAGTCTATGG - Intergenic
992465424 5:76999552-76999574 TTTCCTGTCCCCACAGCCTAAGG + Intergenic
992623518 5:78616441-78616463 CTTCTTGACCACCCCGACTATGG + Intronic
993621137 5:90168897-90168919 CTTGCTGACCTCCCAGTATAAGG - Intergenic
997415133 5:133722307-133722329 TTCCCCCACCACCCAGTCTGTGG + Intergenic
998016096 5:138733622-138733644 TTTCCTGACCACCCAGTCTAAGG - Intronic
998307968 5:141097468-141097490 TTTCCAGACCTCACAGTCTATGG + Intergenic
998860851 5:146442571-146442593 TTTATGAACCACCCAGTCTATGG - Intergenic
1001544543 5:172562882-172562904 TTCCCTGACCTCCCAGACTAAGG - Intergenic
1001626990 5:173144458-173144480 TTCCCTCCCCACCCAGTCTCGGG - Exonic
1002601963 5:180358922-180358944 TTTACAGGCCACCCAGTCTGTGG + Intergenic
1004971764 6:20918283-20918305 TTTCTTAATTACCCAGTCTAAGG + Intronic
1005036331 6:21558387-21558409 TTTCCAAGCCACCCAGTTTATGG + Intergenic
1005567246 6:27108546-27108568 TCTCCTGACCTCCCAGGTTAAGG - Intergenic
1005660209 6:27990618-27990640 TTTACAAGCCACCCAGTCTATGG - Intergenic
1007447985 6:41921583-41921605 TTTCCTGACCCCCCACCCCACGG - Exonic
1007626941 6:43251977-43251999 TTGCCAGACCTCCCAGTCTCAGG - Intronic
1009502474 6:64432360-64432382 TTTTCTGACCTCCTAATCTATGG - Intronic
1009618111 6:66037429-66037451 TTTACTAACTACCCAGTCTCAGG - Intergenic
1009674103 6:66794688-66794710 CTTCATCTCCACCCAGTCTATGG + Intergenic
1009807888 6:68626059-68626081 TTTTTTAACCACCCAATCTATGG - Intergenic
1010930914 6:81801917-81801939 TTTGCCAACCACTCAGTCTATGG + Intergenic
1011253003 6:85392779-85392801 TTTACAGATTACCCAGTCTATGG + Intergenic
1011263819 6:85495249-85495271 TTTTCTGACCACCCACTCAGAGG - Exonic
1011761641 6:90573678-90573700 TTTTCTGACCATCCAATCTTGGG - Intronic
1012986003 6:105877109-105877131 TTTCTAAGCCACCCAGTCTATGG - Intergenic
1013988380 6:116224499-116224521 TTCCCTGGCCAGCCACTCTAAGG - Intronic
1014309393 6:119781586-119781608 TTTCCTGGTTACCCTGTCTAGGG + Intergenic
1014381103 6:120743436-120743458 TTTCCAAGCCATCCAGTCTATGG + Intergenic
1016474081 6:144407057-144407079 TTTTCTGAGCTCCCAGACTAGGG + Intronic
1016536609 6:145113494-145113516 TTTATAAACCACCCAGTCTATGG + Intergenic
1016661164 6:146582624-146582646 TGTCTAGGCCACCCAGTCTACGG - Intergenic
1019093603 6:169561079-169561101 TTTACAAACCACCCAGTTTATGG - Intronic
1020320288 7:6934765-6934787 TGTCCTGAGCACCCAGTTGATGG - Intergenic
1022413928 7:30161740-30161762 ATTGCTGATCACCCAGTCTTCGG + Exonic
1022538186 7:31111169-31111191 TTTCCTGAACTCACAGTCTTGGG + Exonic
1022958603 7:35403710-35403732 TTTCTAAGCCACCCAGTCTATGG + Intergenic
1023456669 7:40346952-40346974 TTTCAAAAGCACCCAGTCTATGG + Intronic
1024701595 7:51909604-51909626 TTTTTAAACCACCCAGTCTATGG - Intergenic
1025094374 7:56086130-56086152 TTTCCTGACCACTCGGTCTAAGG + Intronic
1025523478 7:61772821-61772843 TTTCCAAACCACTCAGTCAAAGG + Intergenic
1026326261 7:69313392-69313414 ATTCCTGCCAACCCAGTCTGTGG - Intergenic
1028807375 7:95044093-95044115 TTTCCTGTTCACCTAGCCTAAGG - Intronic
1028856606 7:95600212-95600234 TTCCTTGACCACCAAATCTAAGG - Intergenic
1030269518 7:107655329-107655351 TTCCCTGAACACCCCCTCTAAGG + Intergenic
1030814856 7:114023323-114023345 TTTATAGATCACCCAGTCTAAGG - Intronic
1031358489 7:120817993-120818015 TTCCCTGATCACCCAGTCCAAGG - Intronic
1032456066 7:132074476-132074498 TTCCCTGACCACCCAAGGTATGG - Intergenic
1034992920 7:155559524-155559546 TTTCTGAGCCACCCAGTCTATGG - Intergenic
1036017001 8:4796375-4796397 ATTCCTGATCTCCCTGTCTAAGG + Intronic
1036508976 8:9383052-9383074 TTTTCTGATCACCCACTTTATGG - Intergenic
1036848342 8:12184963-12184985 TGTCCTGAGCACCCAGTTGATGG - Intronic
1036869704 8:12427244-12427266 TGTCCTGAGCACCCAGTTGATGG - Intronic
1037417790 8:18670114-18670136 TTCTCTGACCATCCAGGCTACGG - Intronic
1037802525 8:22043331-22043353 TTCCCTGCCCACCCGGTCAAAGG - Intronic
1038358627 8:26855065-26855087 TTTACAAGCCACCCAGTCTATGG + Intronic
1038399086 8:27269398-27269420 TTTCCTTCCCTCCCAGTCTCTGG - Intergenic
1038709735 8:29932286-29932308 TTTCCATAGCACCCAGTGTAAGG - Intergenic
1039163342 8:34647626-34647648 TTTACAAGCCACCCAGTCTATGG - Intergenic
1041397452 8:57406143-57406165 TATCGTAGCCACCCAGTCTATGG - Intergenic
1043041157 8:75263545-75263567 ATTCCTGCCCACCCAGATTAAGG - Intergenic
1043416210 8:80053084-80053106 TTTCCAGACCACTTATTCTAAGG - Intronic
1043992727 8:86775874-86775896 TTTACAAGCCACCCAGTCTATGG + Intergenic
1044871698 8:96626111-96626133 TTTTCAAGCCACCCAGTCTATGG - Intergenic
1045224918 8:100235049-100235071 TGTTCAGGCCACCCAGTCTATGG - Intronic
1046087333 8:109454786-109454808 TCTCCTGAGCTCCCTGTCTATGG + Exonic
1046130449 8:109961603-109961625 TTTCCAGACCACCCACAATAAGG - Intergenic
1046348322 8:112967609-112967631 TTTCCTTACCATCCAAACTAAGG + Intronic
1046619984 8:116518871-116518893 TTTCCTGGGCACACATTCTAAGG - Intergenic
1047876544 8:129144333-129144355 TTTCTTGACCTGCCAGCCTATGG - Intergenic
1049487021 8:142871000-142871022 TTTCCGAGCCACCCAGTCTGTGG + Intronic
1049717155 8:144098485-144098507 TTTCCTGACCACTGAGGCTCAGG + Intergenic
1050836175 9:10081649-10081671 TTTATGAACCACCCAGTCTATGG + Intronic
1050869840 9:10553134-10553156 ATTCCTGTCCATCCAGCCTAAGG + Intronic
1052273522 9:26652478-26652500 TTTCTAAACCCCCCAGTCTATGG + Intergenic
1052501915 9:29302870-29302892 TTTCCTGAGAATCCATTCTAAGG + Intergenic
1054824196 9:69555256-69555278 TTCCCTCGCCACACAGTCTAAGG - Intronic
1056889982 9:90482919-90482941 TTTCTAAACCACCCAGTCTATGG - Intergenic
1057187107 9:93063100-93063122 TTTCCTGGCCTCCCAGGCTCAGG + Intronic
1058437546 9:104976886-104976908 TCTCCTGACCACCTATACTAAGG - Intergenic
1059104499 9:111500130-111500152 TTTATAAACCACCCAGTCTATGG - Intergenic
1059728589 9:117033713-117033735 CTACCTGAGCCCCCAGTCTAAGG - Intronic
1060532942 9:124359204-124359226 TTTCCTCCCCACCAATTCTAGGG + Intronic
1061788334 9:133044391-133044413 ATTGCTGACCAGCCAGTCTCTGG + Intronic
1185549993 X:975358-975380 TTTCTAAGCCACCCAGTCTATGG - Intergenic
1185571262 X:1136698-1136720 TTTACAAGCCACCCAGTCTATGG - Intergenic
1185609945 X:1388282-1388304 TTTACAGTCCACCCACTCTATGG + Intronic
1185610013 X:1388734-1388756 TTTACAATCCACCCAGTCTATGG + Intronic
1185631224 X:1517162-1517184 TTTCTAAGCCACCCAGTCTATGG + Intronic
1185682000 X:1896706-1896728 TTTCTAAGCCACCCAGTCTATGG - Intergenic
1185700162 X:2225622-2225644 TTTCTAAGCCACCCAGTCTATGG + Intronic
1185714216 X:2328258-2328280 TTTACAAGCCACCCAGTCTATGG + Intronic
1185800676 X:3007722-3007744 TTTCTAAGCCACCCAGTCTATGG - Intronic
1186144660 X:6612815-6612837 TTTGTAAACCACCCAGTCTATGG - Intergenic
1186387202 X:9121895-9121917 TTTCTAAATCACCCAGTCTATGG + Intronic
1186642320 X:11469111-11469133 TGTTCAAACCACCCAGTCTATGG + Intronic
1186799568 X:13079346-13079368 TTTCCTGGGCACCAAGTCTCTGG + Intergenic
1187128886 X:16481723-16481745 TTTCCTGAACACCCTGTCACAGG + Intergenic
1187192923 X:17053818-17053840 TTTCCTGACCCCTCACTCTGGGG + Intronic
1187608620 X:20915403-20915425 TTTCTAAGCCACCCAGTCTATGG - Intergenic
1187768825 X:22672431-22672453 TTTATAGGCCACCCAGTCTATGG + Intergenic
1188315425 X:28667669-28667691 TTTACAAACCATCCAGTCTATGG - Intronic
1189120125 X:38385452-38385474 TTCCCTGACCACCCAATCTAAGG - Intronic
1189214836 X:39314159-39314181 AATCCTGACCAGCCAGGCTATGG - Intergenic
1189526441 X:41827309-41827331 TTTATAGACCACCTAGTCTATGG - Intronic
1189671367 X:43413678-43413700 TTTATAGGCCACCCAGTCTATGG + Intergenic
1189719368 X:43899662-43899684 TTTCAGGACAACCCAGGCTAAGG - Intergenic
1190048241 X:47129595-47129617 TTTCCAGACCCGCCAGTCTCTGG - Intergenic
1190260787 X:48795619-48795641 TACCCTGACCACCAAGTTTAAGG + Intergenic
1190689117 X:52898954-52898976 GTTCCTGACCACCTGGGCTATGG + Intronic
1190696866 X:52956838-52956860 GTTCCTGACCACCTGGGCTATGG - Intronic
1191007917 X:55730187-55730209 TTCACTGAGCACCCACTCTATGG - Intronic
1191750052 X:64532833-64532855 TTTCCTGGCTGCCCAGTCTTTGG - Intergenic
1193455188 X:81723556-81723578 TGTCCTGAATCCCCAGTCTATGG - Intergenic
1195139581 X:101945791-101945813 TTTATTGATTACCCAGTCTAGGG + Intergenic
1195956442 X:110335963-110335985 TTTTCTGACCACCTACTCTAAGG - Intronic
1196412462 X:115434399-115434421 TTCCCTGACCACCCTATTTAAGG - Intergenic
1196717041 X:118822200-118822222 TTTATAAACCACCCAGTCTATGG + Intergenic
1196722433 X:118867031-118867053 TTTTCTGATCACCCTATCTAAGG + Intergenic
1197129004 X:122982040-122982062 TTTCTAAACCACCCAGTTTATGG + Intergenic
1197667424 X:129238795-129238817 TTCCCTGATCACCTAATCTAAGG + Intergenic
1198541344 X:137643463-137643485 GTTTATAACCACCCAGTCTATGG - Intergenic
1201256639 Y:12114035-12114057 TTTCTAAGCCACCCAGTCTATGG + Intergenic