ID: 998016099

View in Genome Browser
Species Human (GRCh38)
Location 5:138733638-138733660
Sequence CAGGAAAGGCATTTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998016096_998016099 -7 Left 998016096 5:138733622-138733644 CCTTAGACTGGGTGGTCAGGAAA 0: 1
1: 0
2: 6
3: 31
4: 346
Right 998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998016099 Original CRISPR CAGGAAAGGCATTTTGAGGA AGG Intronic
No off target data available for this crispr